Detection Of Mycobacterium Tuberculosis And Mycobacterium Bovis Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Tuberculosis is the most common infectious disease in the world caused by M.tuberculosis. M.bovis is the common cause of gastrointestinal tuberculosis in humans of the developing countries, where there is consumption of raw, unpasteurized milk (Bonsu et al., 2000). Irrespective of the causative agent, either M.tuberculosis or M.bovis, the clinical course of the disease is the same (Collins and Grange, 1983).

The epidemic of HIV infection in developing countries, particularly countries in which M.bovis infection is present in animals and the conditions favour zoonotic transmission, could make zoonotic TB a serious public health threat to the persons at risk (Cosivi et al., 1995; Grange et al., 1994; Daborn et al., 1997).

The diagnosis of pulmonary Tuberculosis includes history, physical examination & radiological findings of either consolidation or cavitations in lung apices. Along with this Acid-fast smears & cultures of sputum are also required. The use of direct smear microscopy is an inexpensive and rapid test for diagnosis of tuberculosis (Kesarwani et al., 2004).Direct smear microscopy does not permit differentiation between species of M.tuberculosis complex .Also, M.bovis grows poorly in standard Lowenstein-Jensen medium, one of the most widely used culture media (Grange et al., 1996).Culture is the gold standard, but it requires a lot of time, whereas clinical urgency necessitates immediate laboratory back up. The PCR amplification of the Mycobacterium tuberculosis DNA is a rapid, reliable method for rapid diagnosis (Mc Adam et al., 2007).

In this study a duplex Polymerase Chain Reaction and its comparison with the conventional methods was carried out, which define the causative organisms of tuberculosis (M.bovis and M.tuberculosis) from samples of sputum and blood taken from patients of active tuberculosis.

The validity of PCR used for patients with active tuberculosis on samples of blood and sputum, especially in patients of extra pulmonary tuberculosis, was checked, as this form of disease is not diagnosed via sputum or blood in routine.

MATERIALS AND METHODS

One hundred sputum and 100 blood samples were collected from suspected TB patients along with the data on the data sheet, admitted in different hospitals of Lahore. The sputum samples were collected in 5ml sterile plastic bottles and placed in 15ml sterile bottles to avoid leakage of infectious samples ,and the blood samples were collected were collected in sterile vacutainers.

TESTS FOR THE DIAGNOSIS AND DIFFERENTIATION OF MYCOBACTERIUM TUBERCULOSIS AND MYCOBACTERIUM BOVIS

Following of the tests were applied to the collected samples of blood and sputum:

Duplex PCR

Conventional Methods

1. Ziehl-Neelsen staining

2. Culture/ Isolation

3. Biochemical tests

The growth obtained after culture were subjected to the following biochemical tests for the confirmation of M.bovis and M.tuberculosis.

Nitrate reduction test

Niacin accumulation test

DNA Extraction by Kit Method:The DNA was extracted from the blood and sputum samples by using FERMENTAS DNA Purification Kit. The Genomic DNA extracted was then subjected to 0.7% agarose gel electrophoresis for determination of quality (Santha et al., 1990).

Duplex PCR for Mycobacterium tuberculosis and M.bovis:The DNA extracted from the blood and sputum samples were subjected to duplex PCR by using two set of primers.For Mycobacterium tuberculosis:

> Forward: pncATB-1.2 (ATGCGGGCGTTGATCATCGTC)

> Reverse: pncAMT-2 (CGGTGTGCCGGAGAAGCGG)

For Mycobacterium bovis:

> Forward: JB21 (TCGTCCGCTGATGCAAGTGC)

>Reverse: JB22 (CGTCCGCTGACCTCAAGAAG)

All the PCR reactions were carried out in an automated cycler (Eppendorf, USA). After amplification, the PCR mixture was analyzed by the gel electrophoresis in 1.5% agarose gel.

DETECTION OF M.TUBERCULOSIS AND M.BOVIS IN HUMAN SPUTUM BY DUPLEX PCR AND CONVENTIONAL METHODS:

Out of 100 sputum samples, 37 were positive for M.tuberculosis, 5 were positive for M.bovis by PCR.Of the 100 sputum samples, ZN staining showed 23 AFB positive, Cultural growth confirmed by biochemical tests resulted in 11 isolates.

Figure 1:

L1 and L2: Both negative for M.tuberculosis and M.bovis

L3: 185 bp band positive for M.tuberculosis

L4: DNA ladder (10Kb)

L5: 185 bp band positive for M.tuberculosis

L6:185 bp with an additional band of 500 bp positive for M.bovis

TOTAL SPUTUM SAMPLES:100

TESTS

M.Tuberculosis

M.bovis

Total

Duplex PCR

37 (37%)

5 (5%)

42 (42%)

ZN Staining

23 (23%)

Culture

11 (11%)

11 (11%)

DETECTION OF MYCOBACTERIUM TUBERCULOSIS AND MYCOBACTERIUM BOVIS IN HUMAN BLOOD BY DUPLEX PCR AND CONVENTIONAL METHODS:

Out of 100 human blood samples, 39 were positive for M.tuberculosis and 4 were positive for M.bovis by Duplex PCR. Of the total positive samples 8 were ZN positive, and 9 were positive for growth on LJ culture.

L1 and L2: 500 bp products (positive for M.bovis).

L3: Negative for both M.bovis and M.tuberculosis.

L4: DNA ladder (100bp)

L5, L6 and L7:185 bp products with additional bands of 500bp (positive for M.tuberculosis)

L8:185 bp positive for M.tuberculosis.

Sample Size

Duplex PCR

Out of PCR(43) positive samples

M.Tuberculosis

M.bovis

ZN staining

Culture for M.tuberculosis

43

4 (9.30%)

39 (90.69%)

8 (18.60%)

9 (20.93%)

DISCUSSION:

Tuberculosis is a major infectious disease in Pakistan. The epidemiological impact of bovine tuberculosis on human health is an important issue especially in the developing countries like Pakistan. Tuberculosis due to M.bovis has a significant value as in the recent years there is increased incidence of tuberculosis due to M.bovis in AIDS patients (O’Reilly et al., 1995).

In the laboratory the diagnosis of tuberculosis is based on the traditional methods of Ziehl-Neelsen’s acid fast staining and culture of the causative organism, M.tuberculosis. The presentation of pulmonary tuberculosis caused by M.bovis and M.tuberculosis is the same in concert with its clinical, radiological, and pathological findings (Danker et al., 1993).

The Duplex PCR proposed in this study is based on one step amplification of two mycobacterial genomic fragments (Shah et al., 2004); a M.bovis-specific 500-bp fragment and M.tuberculosis specific pncA gene. Purified genomic DNA from all the sputum and blood samples were subjected to Duplex PCR using a mixture of four primers, JB21, JB22, pncATB-1.2 and pncAMT-2 (1:1:1.5:1.5). As expected, there were 500-bp and 185-bp amplified products obtained, using the total genomic DNA.

Out of 100 sputum samples, 37 were M.tuberculosis positive while were 5 M.bovis positive, and out of 100 blood samples 39 were positive for M.tuberculosis while 5were M.bovis positive by Duplex PCR. It had been confirmed that species-specific 500 bp fragment is well conserved in M.bovis. The results of this research study are in full accordance with Shah et al. (2004).

This Duplex PCR used in this study is able to successfully differentiate M.bovis from M.tuberculosis strains as in all cases a single product of 500 bp was detected in M.bovis, whereas a product of 185 bp was always detected in M.tuberculosis with or without an additional product of 500 bp. The method is very specific as only M.bovis and M.tuberculosis gave amplification signal (Shah et al. 2004).

M.tuberculosis isolation needs 6-8 weeks on the conventional egg containing media (Ghatole et al.,2005).In this study M.bovis was found positive in 09 suspected tuberculosis patients by Duplex PCR; 6 of them were having signs of extra pulmonary tuberculosis , and 3 were having signs of pulmonary tuberculosis.

The sensitivity and specificity of Duplex PCR was found to be more than the conventional methods, including ZN staining, and Culture. This Duplex PCR is hence more better for the patients, for not only it is more sensitive and gives earlier result, but also it is better diagnostic test for patients of extra pulmonary TB, where other test options include biopsy from site of lesion or other invasive or radiological methods, which is more painful for the patients and is also less sensitive approach for diagnosis.

REFRENCES:

Bonsu, O. A; E. Laing; B.D. Akanmori (2000). Prevalence of Tuberculosis in the Dangme-West district of Ghana, public health implications. Acta trop.76(1):9-14.

Collins, C. H. and J. M. Grange (1983).The Bovine tubercle Bacillus, J. Appl. bacterial. 55:13-39

Cosivi,O ; F-X. Meslin;C.J. daborn and J.M. Grange (1995). The epidemiology of Mycobacterium bovis infection in animals and humans with particular reference to Africa.Scientific and Technical review, 14:733-746

Daborn,C.J ; J.M.Grange and R.R.Kazwala. (1997). The bovine tuberculosis cycle-an African perspective. J. Appl. Bacteriol. 81:27s-32s.

Danker W. M ; N.J. Waecker; M.A. Essey; K.Moser; M.thompson and C.E.Davvis. (1993). Mycobacterium bovis infections in San Diego: a clinic epidemiologic study of 73 patients and a historical review of a forgotten pathogen. Medicine.

Ghatole,M; C.Sable; P.Kamale; S.Kandle; V.Jahagirdar and V.Yemul (2005). Evaluation of biphasic culture system for Mycobacterial isolation from the sputum of patients with Pulmonary Tuberculosis. Indian J. Med. Microbiol. 23:111-113.

Grange,J.M; C. Daborn and O.Cosivi. (1994). HIV-related tuberculosis due to Mycobacterium bovis. Eur Respir J. 7:1564-1566

Grange,J.M; Yates,M.D and de KantorI.(1996) Guidelines for specimen within the Mycobacterium tuberculosis complex.2nded.Geneva:World Health Organization; Unpub. Document WHO/EMC/ZOO/96.4.Thoen CO,Steele JH,editors. Regional and Country.

Kesarwani, R. C; P. Anjana; M. Ashutosh and S. A. Kumar.(2004).Polymerase Chain Reaction(PCR):Its comparison with conventional techniques for diagnosis of extra pulmonary tubercular diseases. Indian J Surg.66:84-88

McAdam A.J.; V.Kumar; A.K.Abbas; N.Fausto and R.N. Mitchell,(2007)Robbins Basic Pathology (8th ed.). Saunders Elsevier. pp. 516-522.

O’Reilly, L.M. and C.J. Daborn (1995). The epidemiology of Mycobacterium bovis infections in animals and man: A review. J. Tuber. Lung Dis. 76(1):1-46

Shah D.H.; S. K. Singh and R.Verma (2004) Mycobacterium bovis specific 500 BP DNA fragment is also present in the genome of Mycobacterium Tuberculosis: A Growing Evidence.16th Vet. Ass.Malaysia Cong.p.224-225

Santha. I. M.; K.K. Koundal and S.L. Mmekta (1990). Biochemical and biophysiology techniques used in recombinant DNA work. In: Genetic Engineering and biotechnology Concepts, Methods and Applications (eds.) V.L. Chopra and A. Nasim.Oxford and IBH Publishing Co. Pvt. LTD. Calcutta, India.pp.9-11.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.