Cyclodextrin Glucanotransferase Background Information Biology Essay

Published:

Cyclodextrin glucanotransferase (1,4-α-D-glucan:1, 4-α-glucanotransferase) or also known as CGTase is an extracellular enzyme which is a member of α-amylase family precisely family 13 of glycosyl hydrolases (Mattson et al., 1995). This family of enzymes is essential enzymes that play vital role in processing starch. The other name of cyclodextrin glucanotransferase is cyclotransferase gylcotransferase since the CGTase belongs to the enzyme group of Glycosyltransferase Hexosyltransferases (Gawande and Patkar, 2001).

The structure of CD plays an important role in its function. The structure of CD can be described as a ring shape and the size of the rings differ in types of CD. The ring-shaped of cyclodextrin is formed due to bipolar activity of it where the interior of CDs are hydrophobic and the exterior are hydrophilic (Min, 2006). This makes CD to easily form inclusion complexes with both organic and inorganic molecules (Min, 2006), where they are capable to include other apolar molecules in case of geometric compatibility (Szejtli, 2004). There are three types of CD which are α-CD, β-CD and γ-CD with 6, 7 and 8 glucose residues respectively. These glucose residues are linked by α-(1-4) glycosidic bond. Based on their major production, CGTase can be distinguished as α-CGTase, β-CGTase and γ-CGTase (Li et al., 2007).

Lady using a tablet
Lady using a tablet

Professional

Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

However, the industrial usages of CDs are more efficient with purified form of CDs not as combination of α-, β- or γ-CD. Therefore, the separation processes which are elaborated and expensive are needed to overcome this. Limitation like this make the usage of CDs at industrial level are rather limited as the total removal of solvent from the CDs is costly (Min, 2006).

In order to accomplish this, the capability of CGTase enzymes that able to produce increased ratio of only one particular type of CDs is crucial as it will avoid using expensive and environmental harmful procedures involving organic solvent. Many researches had been carried out to produce novel CGTase that capable to produce specific CDs with high ratio. One of their novel discovery was CGTase from Bacillus sp. G1 where it able to produce 89% of β-CD and can be increase even up to 100% of β-CD production through some modification (Ho et al., 2005).

In addition to this, further researches had been carried out on Bacillus sp. G1 to increase the industrial value of cyclodextrin. One of the researches was the double mutation of cyclodextrin at subsite -3 which was done by Goh et al. (2008). This research resulted in production of H43T/Y87F mutant from Bacillus sp. G1 where the ratio of β-CD and γ-CD had changed from 90:10 to 61:39 (Goh et al., 2008). Since γ-CD has high value in at industrial level due to its high solubility and largest cavity, this mutant is used in this research.

The enzyme CGTase is built up by combination of five domains namely domain A, domain B, domain C, domain D and domain E. Domain A and B consists of the catalytic residues and form substrate binding groove whereas domain C and E act as starch binding domain. However, the function of domain D is still unknown. CGTase are more active at higher temperature as starch cannot be easily hydrolyzed which makes it crucial to find out which domain is vital in thermostability. Certain proves from previous studies and the fact that domain B contain calcium binding site where the stability at high temperature can be increased if calcium binds to the site has bring up to this research (Goh et al., 2008)

Therefore, this research will be carried out in order to prove that domain B is the domain that responsible for the thermostability of CGTase. This is because nature has designed domain B to consist of calcium binding site. Attachment of calcium to the site has proven to increase thermostability of CGTase by stabilizing the folding or conformation. To prove this, several molecular methods such as overlapping extension PCR will be used in this study to substitute the domain B of CGTase belongs to mesophilic Bacillus sp. G1 H43T/Y87F mutant with selected thermophilic bacteria. This will be done with a subsequent efficient screening and characterization methods to prove this.

Problem Statement

Lady using a tablet
Lady using a tablet

Comprehensive

Writing Services

Lady Using Tablet

Plagiarism-free
Always on Time

Marked to Standard

Order Now

The proving of domain B is responsible to the thermostability of CGTase is mainly done to improve the commercial sustainable use of cyclodextrin. Once the theory had been proved, the pretreatment procedures in industrial production of CD can be eliminated.

1.3 Objectives

To prove the thermal stability of H43T/Y87F CGTase is due to domain B of the enzyme through site-directed mutagenesis method.

To purify, express and characterize the mutant enzyme.

Scope of the research

The scopes of research are as follow:

Designing and synthesizing thermophilic domain B and primers

PCR and overlapping extension PCR

Transformation of the mutant enzyme into E.coli BL21

Positive screening of plasmid and sequencing

Protein expression and purification using Ni-NTA affinity chromatography

Protein characterization which includes effect of pH and temperature to activity and product specifity analysis by HPLC

CHAPTER 2

LITERATURE REVIEW

2.1 Cyclodextrin

Cyclodextrin (CD) or also known as cyclic dextrin is the by-product of degradation of carbohydrates through enzymatic reaction under specific condition. This reaction is catalyses by cyclodextrin glucanotransferase. There are three major CDs which are α-CD, β-CD and γ-CD with 6, 7 and 8 glucose residues respectively (Li et al., 2007).

The shape of cyclodextrin which is in the form of closed ring as shown in Figure 2.1 enables it to form inclusion complexes with variety of molecules both organic and inorganic which are known as guest compound (Volkova et al., 2000). This increases the capability of CD to alter both chemical and physical properties such as solubility and stability of the encapsulated guest compounds. This ring shape of CD consists of hydrophobic CH groups on the inside and hydrophilic hydroxyl groups on the outer side of the ring (Ho et al., 2005).

Figure 2.1 Structure of α-CD, β-CD and γ-CD with their side chains (Szejtli, 2004)

2.1.2 General usage of cyclodextrin

Cyclodextrin plays important role in industries such as cosmetic, pharmaceutical, agricultural and food industries for a very long time. Food industries are one of the oldest industries that use CDs. CD is normally used as stabilizers for flavoring agents as well as able to reduce unpleasant smells and taste (Loftsson, 2006).

The usage of CDs in cosmetic industry was first brought in by Japan as cosmetic products are preferred from natural origin. Thus, CDs play vital role as stabilizers of chemically labile compound. Other than that, CDs are also used to obtain prolonged action and to reduce both unpleasant smell and local irritation (Loftsson, 2006).

Apart from that, CDs are also used widely in pharmaceutical industry starting of 1970s through the production of prostaglandin E2/β-cyclodextrin in Japan. CDs are mostly used in this industry as solubilizers, stabilizers and also to reduce local drug irritation (Loftsson, 2006).

Although CDs have a lot of function in pharmaceutical industry, the dosage of CD usage is rather important. Since the excess usage of CD wile reduce the optimal effect, therefore, CDs are used in very small amount in pharmaceutical industry. This is done taken account of toxicological consideration, production cost and drug bioavailability in CD (Loftsson, 2006).

Cylodextrin Glucanotransferase (CGTase)

Cyclodextrin glucanotransferase (1,4-α-D-glucan:1, 4-α-glucanotransferase) or also known as CGTase is an extracellular enzyme which is a member of α-amylase family (Mattson et al., 1995). CGTase is also known as cyclodextrin glycosyltransferase, cyclomaltodextrin glucanotransferase and cyclomaltodextrin glycosyltransferase (Qi and Zimmermann, 2005). CGTase catalyses the cyclization reaction in where starch are break down into cyclodextrins. This enzyme also capable to catalyze other reactions such as coupling reaction, disproportionation reaction and possesses a week hydrolyzing activity (Volkova et al., 2000). The mechanism of CGTase is shown in Figure 2.2.

Figure 2.2 Reaction mechanism of CGTase which includes disproportionation, hydrolysis and cyclization (Qi and Zimmermman, 2005)

Throughout the years, CGTase have been identified in many microorganisms. The first discovery of it is in Bacillus macerans (Zimmermann, 20005). Other microorganisms that capable in producing CGTase are Bacillus firmus, Bacillus circulans, Bacillus autolyticus, Klebsiella pneumonia and Brevibacterium sp. According to Zimmermann (2005), it had been discovered through genome sequencing that Xanthomonas, Streptococcus and Nostoc strains also able to produce CGTase.

CGTase consists of five intervened domains namely domain A, domain B, domain C, domain D and domain E. Domain A shaped as TIM barrel and present in all α-amylase family members. Domain A and B consists of the catalytic residues and form substrate binding groove whereas domain C and E act as starch binding domain. However, the function of domain D is still unknown. Domain C also contains maltose-binding sites (MBS) where this domain also involves in stability of the enzyme. Domain E had been identified to contain two maltose-binding sites thus also function as a putative raw-starch-binding region (Shin et al., 2000).

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

Figure 2.3 shows the illustration of all the five domains in CGTase. Domain A is illustrated as A1 and A2 because domain A is a discontinuous domain where domain B protrudes out in between domain A.

Figure 2.3 Schematic representation of the location of each domain in CGTase

2.3 Thermostability

2.3.1 Thermostability of protein

The thermostability of protein had been long studied by many researchers throughout the years. This is crucial in studying the physical and chemical behind protein stability and folding. According to Kumar (2000), heat tolenrance enzymes have higher resistances to proteolysis compared to mesophiles due to their greater rigidity.

Thermostability of proteins have been long discovered in many researches which resulted that thermostability of protein is due to greater hydrophobicity, increased polar surface area, decreased occurrence of proline residues and increase of salt bridges (Goh et al., 2008). Proteins at higher temperature also have higher intrinsic thermal stability with ability to retain their basic folding characteristic than normal mesophilic proteins (Seung and Young, 2003).

2.3.2 Thermostability of CGTase

CGTase that is stable and active at high temperature is essential in industrial usage of CD. This is because due to low optimum temperature of mesophilic CGTase which is only around 55°C, starch needs an extra treatment before it can be degraded by CGTase. Starch which is stable at high temperature has to be liquefied and solubilize prior degradation. This process will be carried out at temperature as high as 110°C. Therefore, α-amylase is added to solubilize starch (van der veen et al., 2000).

However, addition of α-amylase produces by-product of maltodextrin. Maltodextrin capable to act as acceptor molecules and competitively inhibits the binding of starch to CGTase. This in overall reduces the production of CD (van der veen et al., 2000).

CGTase which is able to solubilize starch at high temperature eliminates α-amylase pre-treatment during the primary liquefaction of starch or gelatinization. This function of high temperature CGTase shortened the total time of cyclodextrin production thereby increases industry value of CD. Besides that, heating and cooling in between bioprocessing steps can be reduced as well.

There are few thermophiles that are discovered that able to produce CGTase where the optimal temperatures of these are higher than the mesophiles. The thermostability of CGTase from mesophilic Bacillus sp. G1 and some of the selected thermophiles is shown in Table 2.1.

Table 2.1 Selected CGTase and their optimum temperature

­­­­­­­­­­_______________________________________________________________________

CGTase Optimum temperature (°C) References

Bacillus sp. G1 60 Goh et al. (2008)

T. thermosulfurigenes 65 Yamamoto et al. (2000)

Anaerobranca gottschalkii 65 Goh et al. (2008)

CHAPTER 3

MATERIALS AND METHODS

3.1 Synthetic gene material

Two synthetic thermophilic domain B will be commercially synthesized in the form of recombinant in pUC 57 vector. The two domains B are from Thermoanaerobacterium thermosulfurigenes and Anaerobranca gottschalkii respectively. Both of the Domain B will be substituted into mutant H43T/Y87F to prove the thermal stability via overlapping extension PCR.

Figure 3.1 Flow chart of total research

The sequences of the synthesized domain B are as follow:

Thermoanaerobacterium thermosulfurigenes

TGGATTTCACGCCAAATCATagcaacccgaacgatgcgggcgaatatggcgcgctgtatgataacggcacctttgtgattgattatccgaccgatgcgaactatgcgaccgtgcatccgattaccaaaagcctgagctatatttataaccataacggcggcattaccaactggaacgatcgctgggaagtgcgctataaaaacctgtttaacctggcggatctgaaccagctgAACACAGTCATGGATCAATA

Anaerobranca gottschalkii

TGGATTTCACGCCAAATCATaccagcccggcggaagtgaacaacccgaactatgcggaagatggcaacctgtataacaacggcgaatttgtggcgagctatagcaacgatctgaacgaaattttttatcattttggcggcaccgattttagcacctatgaagatagcatttatcgcaacctgtttgatctggcgggcctgaacctgaacAACACAGTCATGGATCAATA

In both of the sequences above, the indicated capital letter sequences are from CGTase H43T/Y87F mutant and the remaining sequences are from respective thermophilic CGTase.

3.2 Glycerol Stock of Desired Bacteria

3.2.1 Preparation of Luria Bertani(LB) Media and LB Agar plates

To prepare 500ml of this media, 5.0g of tryptone powder, 2.5g of yeast extract and 2.5g of sodium chloride will be added into 500ml of distilled water and will stir until the powder fully dissolve. The solution will then be autoclaved and kept at 4°C.

To prepare the agar, 7.5g of agar powder will be added into the media and will be dissolved completely. The media will then be autoclaved and cooled down to pour on Petri dish.

Sterilized Petri dish will be use to prepare the LB Agar plate. In each Petri dish, about 25mL of LB media will be poured. The media will be left to solidify and the solidified agar plates will be kept at 4°C.

3.3 Transformation of Synthesized Gene into E.coli DH5α

The recombinant plasmid pUC 57 which carry synthesized Domain B is delivered in the form of liquid phase. To maintain the recombinant and for further use, the recombinant will be transformed into the host cell which is E.coli DH5α. Transformation will be done using the TSS method.

3.3.1 Preparation of TSS solution

The TSS solution for bacterial transformation will be carried out according to Chung et al. (1989).

To prepare 10mL of TSS solution, 8.5mL LB medium will be added to 1mL of PEG, 0.5mL of DMSO and 0.25mL of magnesium chloride at pH6.5. The resulting solution will be stirred until fully dissolved and autoclaved prior usage. The TSS solution can be kept in 4°C as short term storage.

3.3.2 Preparation of TSS bacterial competent cells

An overnight culture of E.coli DH5α will be diluted with LB broth at 1:50 dilution factor. The broth will then be incubated in a shaker at room temperature until it reaches the OD reading of 0.25-0.4.

After that, the cell culture will be kept on ice for 20 minutes. The cell culture will then centrifuged with the speed of 1500 rpm for 5 minutes at 4°C to collect the pellet. The supernatant will be completely removed and 1mL of ice-cold TSS solution will be added in each tubes. The cells will be suspended in the solution through gentle pipette and the tubes will then be placed in ice for further use.

3.3.3 Transformation of TSS-Competent Cells

The ice-cold competent cells in each tubes will be added with 10µL (100pg-10ng) plasmid. The tubes will be gently flicked to mix the competent cells with the plasmid. The tubes will then be incubated in ice for 30 minutes with occasional mixing. Immediately after 30 minutes, the tubes will be incubated at 42°C for 2 minutes and followed by incubation in ice for another 2 minutes.

The transformed cell will then be added with 0.8mL of LB broth in each tube. The tubes will be shook for mixing and will be incubated at room temperature in a shaker for approximately 1 hour.

After an hour of incubation, the transformed cell will be plated on LB agar plates with ampicilin to screen the transformed cells. Approximately 100-200µL of cell culture will be plated on each plate and left to grow over night at room temperature.

3.4 Plasmid extraction by the Alkaline Lysis Method

The plasmid will be extracted using Alkaline Lysis method according to Ausubel (1987) with modifications.

A single white colony will be inoculated into 10mL of sterile LB/ampicillin broth and grown overnight at room temperature. The next day, 1.5mL of the cells will be transferred into several microcentrifuge tubes and centrifuged for 5 minutes at 8000 rpm to collect the pellet. The supernatant will be discarded and the tube will be centrifuged again to completely discard any trace of liquid.

The cells in all the tubes will then be transferred into a single 1.5mL tube. The combined pellet will be suspended in 100µL GTE solution, vortex briefly for 10 seconds and kept in ice for 30 minutes. This will be followed by addition of 100 µL of NaOH/SDS solution and the content was inverted several times and placed in ice for 3 minutes for the lysis reaction to occur. Following this, 300µL of 5M potassium acetate pH6.0 will be added and the tube will be inverted few times until a white precipitate formed.

The mixture will be centrifuged at 10 000 rpm for 5 minutes to precipitate the pellet. Approximately 500µL of the supernatant will be transferred into a fresh sterile 1.5 mL tube. Then, 2 volumes which will be 1000µL of cold absolute ethanol will be added and the content will be mixed by gently inverting the tubes.

The tube will be centrifuged at 13 000rpm for 5 minutes and supernatant will be discarded. Produced pellet will be suspended in 500µL of 70% ethanol and centrifuged at 13 000rpm for 2 minutes. The supernatant will be discarded and the plasmid will be air dried for 15 minutes.

Finally, the pellet will be dissolved in 50 µL of sterile distilled water and stored at -20°C for further use. Agarose gel electrophoresis will be carried out to determine the band and size of the extracted plasmid.

3.5 Polymerase Chain Reaction (PCR) Amplification

The amplification of domain A1 of CGTase from Bacillus sp. G1 H43T/Y87F mutant, domain B of CGTase of selected genes and domain A2-C-D-E of CGTase from H43T/Y87F mutant will be done separately by adding the following reagents.

The reagents are 10X buffer, dNTPs, MgCl2, designed gene specific reverse and forward primers, Template DNA and KOD Polymerase. The reagents will be added together to become 50 µL with the addition of sterile distilled water. The proportion of the reagents will be varied for each amplification.

PCR is performed using the following protocol where the denaturation, annealing and extension process were repeated for 35 cycles.

Initial denaturation 95°C for 2 minutes

Denaturation 95°C for 20 seconds

Annealing 55°C for 20 seconds

Extension 70°C for 10 seconds

Final extension 70°C for 5 minutes

There are three types of primers used in the whole procedures. The primers are reverse and forward primers for domain B, reverse and forward primers for domain A1 and reverse and forward primers for domains A2, C, D and E. The forward primers for domain A1 and reverse primers for domains A2, C, D and E will then be used as the external primers in overlapping extension PCR. The primers sequences are as follows:

Domain B forward primer: 5' CATGGATTTCACGCCAAATCAT 3'

Domain B reverse primer: 5' TAAATATTGATCCATGACTGTGTT 3'

Domain A1 forward primer (external forward primer): 5' CTCGGATCCGGACGTAACAAACAAAGTCAATTACTCA 3'

Domain A1 reverse primer: 5' ATGATTTGGCGTGAAATCCATG 3'

Domain A2, C, D and E forward primer: 5' AACACAGTCATGGATCAATATTTA 3'

Domain A2, C, D and E reverse primer (external reverse primer): 5' GCCAAGCTTCCAATTAATCATAACCGTATCTGTTCCGG 3'

3.6 Overlapping Extension PCR

Overlapping extension PCR will be done with 2 phases. The first phase will be the fusion of desired domain B with domain A1 of CGTase mutant H43T/Y87F and the second phase will be the fusion of fused domain A1-B with domain A2, C, D and E of CGTase H43T/Y87F mutant. The illustration of these two phase procedures of the overlapping extension PCR is shown in Figure 3.2.

Separate PCR of all three portion

Domain A2, C, D and E of H43T/Y87F CGTase

Domain A1 of H43T/Y87F CGTase

Synthesized domain B of selected thermophiles

Overlapping -extension PCR between domain A1 and domain B

Synthesized domain B of selected thermophiles

Domain A1 of H43T/Y87F CGTase

Overlapping - extension PCR between domain A1-B and domain A2, C, D and E

Domain A2, C, D and E of Bacillus sp. G1 CGTase

Transformation of mutant CGTase into E.coli BL21

Figure 3.2 Schematic diagram of PCR and Overlapping extension PCR

3.7 Transformation of fused CGTase

The procedure of this transformation will be similar with the transformation procedure at method 3.2 and 3.3.

3.8 Positive screening

3.8.1 Preparation of LB/Ampicilin plates

In every solidified LB agar plates, 100µL of ampicilin (100mg/mL) will be spread and the layer will be left to dry for approximately 30 minutes in laminar flow hood. The plates are allowed to dry and kept in 4°C for further use.

3.8.2 Screening for positive transfomant

This screening will be carried out to identify successful transformants. Randomly, a few white colonies will be picked using sterile toothpicks and will be plated on fresh LB/ampicilin plates. Plasmid of the selected transformants will be isolated and the size of the recombinant will be identify. Colony PCR approach will be done for selecting plasmid that contains the gene of interest.

.

3.9 Sequencing

Positive clones identified in the earlier step will be sequenced for confirmation.

3.10 Protein Expression and Purification

3.10.1 Ni-NTA Affinity Chromatography

Two newly constructed mutant CGTase with Domain B been substituted will be expressed using pET22/E.coli BL21 system. Post induction temperature will be lower for instance 25°C to avoid formation of inclusion body. Cell free supernatant will be batch purification under native condition with the use of tandem 1 mL pre-packed Hi-Trap Ni-NTA Sepharose column (Amersham Bioscience, GE). AKTA Prime will be use to facilitate the purification step. All work will be done at 4°C unless specified.

The snap-off end of Ni-NTA column outlet will be removed and distilled water will be introduced into the column with the volume of 0.5mL- 1mL perminute. The column will then equilibrated with 7 column volume of binding buffer which comprise of 20mM of sodium phosphate and 5mM of imidazole at pH 7.4. This will be followed by addition of 20 mL of sample into the column.

The elution buffer will then be added with 10 column volume of elution buffer which contain 20mM of sodium phosphate, 0.5M of sodium chloride and 500mM of imidazole at pH 7.4. The flow rate will be applied at approximately 1mL/min.

Fraction of samples will be collected using fraction collector. Each samples will be assay for protein content and CGTase activity. The fractions with activity will be pooled and dialyzed against 0.1M phosphate buffer at pH 6.0.

3.11 Protein Characterization

Few types of protein characterization assays will be carried out to further characterize the mutant enzyme. The types of assays that will be carried out include thermostability assay, pH profile and HPLC analysis.

CHAPTER 4

EXPECTED RESULT

The synthesized thermophilic domain B is expected to substitute the original domain B in CGTase H43T/Y87F mutant through overlapping extension PCR method. The purified PCR product is expected to clone into E.coli BL21 and plasmid will be extracted to send for sequencing. The major expected outcome of this research will be proving that domain B is the domain that responsible in thermostability of CGTase. In order to prove this, protein expression and characterization will be done.

REFERENCES

Ausubel, F.M. (2000). Current protocol in molecular biology. John Wiley and

sons, New York, 2:4.6-4.7

Biwer, A. and Heinzle, E. (2004). Process modeling and simulation can guide process

development: case study α-cyclodextrin. Enzyme and Microbial Technology. 34: 642-650.

Chung C.T., Niemela S.L. and Miller R.H. (1988). One-step preparation of competent

Escherichia coli: Transformation and storage of bacterial cells in the same solution. Proc. Natl. Acad. Sci. USA. 86: 2172-2175

Gawande, B.N. and Patkar, A.Y. (2001). Purification and properties of a novel raw

starch degrading- cyclodextrin glucosyltransferase from Klebsiella pneumonia AS-22. J. Enzyme and Microbial Technology. 28: 735-743

Ho, K.S., Said, M., Hassan, O., Kamaruddin, K., Ismail, A.F., Rahman, R.A., N.A.N.

and Illias, R.M. (2005). Purification and characterization of cyclodextrin glucanotransferase from alkalophilic Bacillus sp. G1. J. Process Biochemistry. 40 (3-4):1101-1111.

Kahar, U.M. (2009). Purification and characterization of recombinant cyclodextrin

glucanotransferase (CGTase) using chromatography approach. Bachelor of Science with Honours Thesis. Universiti Teknologi Malaysia

Kumar, S., C.J. Tsai and R Nussinov. (2000). Factors enhancing protein thermostability.

Protein Eng. Des. and Sel. 18(2):179-191.

Li, Z., Wang, M., Wang, F., Gu, Z., Du, G., Wu, J. and Chen, J. (2007). γ -

Cyclodextrin: A review on enzymatic production and applications. Appl. Microbiol. Biotechnol. 77:45-255

Loftsson, T. and Duchene, D. (2006). Historical perspectives: Cyclodextrins and their

pharmaceutical applications. Int. J. of Pharmaceutics. 329:1-11

Mattson, P., Battchikova, N., Sippola, K., and Korpela, T. (1995). The role of histidine

residues in the catalytic act of cyclomalodextrin glucanotransferase from Bacillus circulans var. alkalophilus. Biochimca et Biophysica Acta. 1247:97-103

Muniandy, K. (2009). Cloning and molecular characterization of DNA fragments

obtained from 5'- RACE of starch branching enzyme from Metroxylon sagu. Bachelor of Science with Honours Thesis. Universiti Malaysia Sarawak, Malaysia.

Ong Rui Min. (2005) Molecular cloning of cyclodextrin glucanotransferase gene from

Bacillus sp. G1. Master of Science with Honours Thesis. Universiti Teknologi Malaysia

Qi, Q. and Zimmermann, W. (2005). Cyclodextrin glucanotransferase: From gene to

applications. J. Appl. Biotechnol. 66: 475-485.

Seung, P.P. and Young, J.Y. (2003). Protein thermostability: Structure- based difference

of residual properties between thermophilic and mesophilic proteins. J. of Mol. Cat.: Enzymatic. 26: 257-264

Shin, H.Y., Park, T.H. and Lee, Y.H. (2000). Site-directed mutagenesis and functional

analysis of Maltose-Binding Site of β-Cyclodextrin glucanotransferase from

Bacillus firmus var. alkalophilus. Biotechnology Letters. 22: 115-121.

Szejtli, J. (2004). Past, present and future of cyclodextrin research. J. Pure Appl. Chem.

10: 1825-1845

Volkova, D.A., Lopatin, S.A. and Varlamov, P.V. (2000). One-step affinity purification

of cyclodextrin glucanotransferase from Bacillus sp. 1070. J. Biocatalysis. 33: 67-69