Construction Of Dna Vaccine In Pvax1 Mammalian Vector Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

The main aim of this research study was to observe the effectiveness in terms of its DNA vaccine clone stability which was produced from the Pasteurella multocida virulence gene of Serotype B, PMB202 (the recombinant clone ABA392) that would be used against the diseases caused by the bacteria itself. It can be accomplished by cloning the virulence gene into the mammalian vector system.

The cloning into mammalian vector via E. coli TOP10 host was successfully done and stably maintained in the pVAX1 mammalian vector. With this success, it is a great hope for the future DNA vaccine research to treat against diseases caused by Pasteurella multocida such as the haemorrhagic septicaemia or any other diseases which related to haemorrhage especially in human beings.

Therefore, further research can be done this newly constructed recombinant clone by studying the expression of the ABA392/pVAX1 recombinant on mammalian cell lines. Not only that, experimental studies can also be done in animal models, particularly mice to check the immunogenicity, lethality, and effectiveness of the recombinant clone as DNA vaccine.

Pasteurella multocida is a gram-negative, non-motile, and non-spore forming coccobacillus with bipolar staining features such as the Gram Stain. It is small and can occur as single coccobaccilus, diplococcobacillus, and occasional form of short chains. This microorganism also has variation in terms of uniform arrangements and length. Usually, Pasteurella multocida colonies in Blood Heart Infusion (BHI) agar have diameter of 0.5 to 1.0 mm. It has smooth in the entire edge. With continuous incubation of 37°C, the diameter can increase in size to 1.0 to 2.0 mm. These pure colonies are smooth, glistening, transparent, and greyish-yellow in colour with addition of a butyrous consistency (Jamal et al., 2005).

In bovine upper respiratory tracts, Pasteurella multocida often existed as commensalisms (Chen et al., 2003). However, it is also a primary and opportunistic animal and human pathogen globally with only some in which there is no epidemiological evidence (Hunt et al., 2001) except in plasmid profiling (Jamal et al., 2005). Common infection in humans mostly occurred through animal bite, scratch, or lick from cats or dogs. This can be seen in diseases such as the bovine respiratory disease (BRD) complex (Chen et al., 2003). Meanwhile, in animals, common diseases such as progressive atrophic rhinitis (Petersen et al., 1991), pneumonia (Register et al, 2007), fowl cholera (Harper et al., 2003), and haemorrhagic septicaemia (due to acute septicaemic Pasteurellosis from Serotype B) (Jamal et al., 2005) can occur in animals such as swine (Petersen et al., 1991), birds (Harper et al., 2003), water buffalo, and cattle (Jamal et al., 2005).

1.2 DNA Vaccine for haemorrhagic septicaemia diseases

The rising need of curing various diseases and eliminates pathogen efficiently gives rise to the new, designed technique known as DNA vaccine. Introduced few years ago, this novel technique stimulates cellular and humoral immune responses of the living host against the protein antigens produced from the introduced foreign gene products through direct injection (Scuderi, 2003). The plasmid injection usually administrated through intravenous, intradermal, or intramuscular (Scuderi, 2003). Once injected, the detoxified virulence gene of a pathogen is expressed and protein antigen is produced, causing induction of immune response such as the activation of MHC Class I and II protein pathways (Scuderi, 2003). Antibody is then produced from B cells (humoral response) to counter the antigen produced, and thus, indirectly eliminates the pathogen. In Pasteurella multocida, the DNA vaccine is further sub-constructed from genetically detoxified recombinant clone ABA392 (Salmah, 1997 and 2000) with either 5' truncated or full-length, and also with two different vectors (Register et al., 2007): pGEM-T cloning vector which is used to carry and reproduce the virulence gene fragment, and the mammalian vector which is used to carry the virulence gene fragment into the mammalian host cell such as mice (Chen et al., 2003).

Although DNA vaccine could not substitute polysaccharide-based subunit vaccines (Scuderi, 2003), it has much more benefits and advantages such as enable induction of antigen expression that resembles native viral epitopes compared to other types of vaccines. DNA vaccines can also be delivered in a single dosage with only a microgram of recombinant vectors to be induced, relatively lower cost, and stable temperature that allows easy storage and transport. It also has therapeutic potential for ongoing chronic viral infections (Scuderi, 2003).

The DNA vaccine produced against Pasteurella multocida (especially serotype B, PMB202) could provide future treatment and prevention for outbreaks such as haemorrhagic septicaemia which had occurred in the year 2005. According to Jamal (2009), mice can used as models to analyse the onset of symptoms or signs within 37 to 48 hours in which it is similar to humans and poultry as long as the mice is under stress and at the same time, is also immune-suppressed. This information are vital because, most Malaysians are more susceptible to this pathogen due to close contact with livestock such as cows and goats, poultry, and domestic pets such cats and dogs (Jamal et al., 2005).

1.3 Origin of recombinant clone ABA392 from Pasteurella

multocida serotype B (PMB202)

The recombinant clone ABA392 that has the virulence gene of 921 base pairs (bp) was first constructed from genomic DNA of Pasteurella multocida Serotype B strain PMB202 (Salmah, 1997 and 2000). In experimental immune-suppressed mice, the pathogenecity closely resembles of PMB202 such as reluctance to move, decrease in feed, lesions around eye, and roughness of coat, and lung congestion (Jamal, 2009). Even with mice lethality test, the expressed clone from both ABA392 and PMB202 is capable to cause haemorrhagic septicaemia-like symptoms except that haemorrhagic septicaemia do not affect mice without immune-suppressed. The fragment insert of ABA392 was subcloned into an expression system, pQE32, for its further identification and characterization (Jamal, 2009). The resultant recombinant clone, CSI57J, however was found unstable and avirulent in mice after a period of six months (Unpublished, 2010).

For this research study, the ABA392 recombinant clone can be used as a potential DNA vaccine due to its immunogenecity with at least 66.7% protection based on three times dose vaccination schedule. Even with passive mice protection test, the results are also similar with protection of 66.7%. Moreover, it has positive result with presence of antibody based on ELISA test. However, the vaccination is not effective when is given less than three time dose vaccination schedule or if the mice is immune-suppressed where it do not have the presence of immune sera in them.

From the recent study by Jamal (2009), it is proven that ABA392 recombinant clone can be a potential DNA vaccine in presence of immune sera. This is vital for the future progress such as the vaccine treatment against deadly diseases caused by haemorrhagic septicaemia Pasteurella multocida Serotype B.

OBJECTIVES

The main aim of this research study is to observe the effectiveness of the DNA vaccine clone produced from the Pasteurella multocida virulence gene of Serotype B, PMB202 (recombinant clone ABA392) that can be used against the bacteria itself. It can be accomplished by cloning the virulence gene into the mammalian vector.

The objectives of the research study are:

2.1 To amplify the gene fragment of ABA392 via PCR and subclone into the pGEM-T cloning vector (~3.0kb).

2.2 To clone the gene fragment of ABA392 into the pVAX1 mammalian vector (size of vector ~2.9kb to 3.0kb).

MATERIALS AND METHODS

3.1 Plasmid cloning in pGEM-T vector

3.1.1 Forward and reverse primers design from PMB202 strain

The primer sequence was designed and sent for production prior to sub-cloning of ABA392 into both the pGEM-T vector and mammalian vector. The primer design (PMM) sequence used to amplify the desired ABA392 gene in both pGEM-T cloning vector and pVAX1 mammalian vector are as below:

Forward: F-PMM-5'-TCAGCAAGCTTATGAGTCTTTTGTTCTGT-3'

Reverse: R-PMM-5'-TAATTGCGCCGCCTATCGTCGGTGGAAA-3'

The resulting gene of insert is about 803 bp.

Gene Amplification in Polymerase Chain Reaction (PCR)

Forward and reverse primers were used in the PCR preparation. Distilled water, magnesium ion (Mg2+), buffer A (10x buffer, without Mg2+), and Taq polymerase were used to prepare the master mixture. The DNA template used was from Pasteurella multocida Serotype B (PMB202) while the virulence gene insert used was from the recombinant clone ABA392. The PCR product obtained was then confirmed and purified by gel electrophoresis and gel extraction technique. It was then kept at 4°C overnight before is used for cloning and transformation process.

3.1.3 Ligation into pGEM-T vector and transformation of E. coli JM109 strain

The cloning process involved the ligation buffer reaction of the pGEM-T vector, PCR product, T4 DNA ligase, and 2x buffer. The presence of the ligation product was confirmed via 1% agarose gel electrophoresis in 1x TBE buffer. For transformation, competent cells of E. coli JM109 were used. The transformed cells were then cultured and incubated overnight in Luria-Bertani (LB) Petri dish which previously mixed with Amplicilin, X-gal, and IPTG for antibiotic resistance and blue-white colony screening.

3.1.4 Colony screening

The colonies were screened by blue-white colony screening and also by PCR. The colony library was also prepared for inoculation of the positive colonies found. After PCR, the samples were analyzed through agarose gel electrophoresis (1% agarose, 1x TBE Buffer). For positive colonies found, it was inoculated into the LB broth containing 5µl of 100mg/ml Amplicilin. LB broths were kept overnight in the shaking incubator at 37°C and 250 rpm for further growth.

3.2 DNA fragment extraction from the pGEM-T vector

3.2.1 Plasmid isolation of pGEM-T vector

The LB broths which previously grown overnight were used in the plasmid isolation. The isolation was carried out within a day with steps involving centrifugation, sample keeping in ice box, water bath incubation, and usage of hazardous solutions such as phenol, chloroform, and chisam. Isolated plasmid was resuspended in 50µl water and kept overnight at -20°C. Gel electrophoresis was carried out to confirm the presence of desired of desired DNA fragment in pGEM-T vector. The Sodium dodecyl sulphate (SDS) used in the solution II is the type Tween 20, used in denaturing bacterial cells where it was freshly prepared to increase effectiveness of denaturing the bacterial cells.

3.2.2 Restriction enzyme digestion

It was carried by reaction between the isolated pGEM-T vector and restriction enzymes, HindIII and NotI with the early addition of bovine serum albumin (BSA) and both V2 (for HindIII) and Tango (for NotI) buffers. Gene sequence for restriction enzymes (for both pGEM-T cloning vector and pVAX1 mammalian vector):

HindIII: AAGCTTG

NotI: CGCCGGCG

3.2.3 DNA extraction from the agarose gel

The desired fragment of DNA from the gel was obtained by using the QIAquick Gel Extraction Kit (Qiagen, USA) from the Molecular Bacteriology Laboratory, Department of Molecular Medicine, Faculty of Medicine, University of Malaya. It was specialized in extracting from gel that had ran through the electrophoresis and then is dissolved and separated by series of centrifugation steps which involved the addition of specific buffers from the kit. The extraction was carried according to the QIAquick Gel Extraction Kit Protocol.

3.3 Subcloning into the pVAX1 mammalian vector

3.3.1 Restriction enzyme digestion of pVAX1 mammalian vector

The mammalian vector, pVAX1 was digested using the similar protocol with the restriction enzymes HindIII and NotI with the presence of BSA, V2 buffer, and Tango buffer.

Ligation into pVAX1 vector and transformation of E. coli TOP10 strain

The ligation and transformation process was carried out with similar protocol with the ligation and transformation of the recombinant subclone pGEM-T vector. All the procedures involved were similar except that the E. coli TOP10 strain was used instead of the JM109 strain and the competent cells were grown overnight in the LB Petri dish which was prepared with the addition of Kanamycin only.

3.3.3 Colony screening

The colonies were screened by Kanamycin antibiotic resistance screening and by PCR for any colonies found. The colony library was prepared for future usage for inoculation of the positive colonies. After PCR, the samples were analyzed through agarose gel electrophoresis (1% agarose, 1x TBE Buffer). For any positive colonies found, it was inoculated into the LB broth containing 2.5µl kanamycin. LB broths were kept overnight in the shaking incubator at 37°C and 250 rpm for further growth.

Plasmid isolation of constructed recombinant pVAX1 mammalian vector

Isolation was carried out similar to the plasmid isolation of the recombinant subclone pGEM-T vector that had been constructed before. Isolated recombinant subclone pVAX1 was resuspended with 50µl water and kept overnight at -20°C. Samples were then analyzed through gel electrophoresis to confirm the presence of insert DNA in recombinant subclone pVAX1 mammalian vector.

3.3.5 Plasmid screening by PCR

The plasmid samples were amplified by PCR and then analysed through gel electrophoresis. There were bands found in the range between 2.5kb to 3.5kb in the samples that confirmed the presence pVAX1 mammalian vector (actual size ~2.9kb to 3.0kb). The plasmids were then sent for DNA sequencing for further conformation.

3.3.6 DNA sequencing

The recombinant pVAX1 mammalian vector samples were sent for sequencing. A chromatogram obtained for DNA sequence, was further analysed using the BLAST search for its homology or match both the DNA gene and protein sequence in the recombinant pVAX1 mammalian vector.

Below is the gene and protein sequence for Pasteurella multocida strain PMB202 virulence gene. These sequence was used to compare with the insert available found in the recombinant mammalian vector that had been subclone earlier.

Primer sequence for pVAX1 mammalian vector (used for DNA sequencing):

Forward: pVAX-F-5'-TTAATACGACTCACTATAGGG-3'

Reverse: pVAX-R-5'-TAGAAGGCACAGTCGAGGCT-3'

Pasteurella multocida strain PMB202 (and recombinant gene ABA392) functional virulence DNA gene sequence (about 803bp out of 921bp):

ATGAGTCTTTTGTTCTGTCGCTTGTCGAAGAGAGTGTTGAGCTGGCTA

ACGAGCATAGACTGATACTTCTTGAGCTAGGTAGCCGTCTTTTTTTGA

GTGCTGAGCCGGTTTTCAGGGCGGACTTCCTACAAGTGGCCGAGAAG

TATCTAAATAGGCTTGGCTGATACGATTCTTATCGCTTTCCACAGAGC

CCAAATAAGGCACTTGCTTCATTTGAGATTCTCTGCCAAGACTAGGGC

TCCCTCCTCTGATCGCTTCAAGCCCATGACCAAGCCGACCGGCAGACA

CAGGATGACTCAGTAGGGGCCGGGGCGATGGAATACGGCATAGAAAT

CCGAGATCATGACCGCCATTGCGAAAATCAGCAGGGATTGTGTGCGC

GACTCTTGCCCCGCGTATTGGCGCATTACCATCGGAATATCAGGTCCT

CAAGGAACAGTATCCCGAGCAGTAGGGCGCGACACTCGACAACCTGC

TACGCAAGATAGCAGCTGCGATCCGCAGCTGAAGCAACCTGCCAGTC

CCGATAAGAGCCCGGTAGACATCCTTTACTACCATACCGATCACTTGG

GCACGCCGAGGGAGCTGACCGACAAGGATGCCGCATCGTCTAAGTCG

CGACGTACAAGGCATGGGGTAACACGGTGAAGATCGAGCGGCCTGGA

CGACTGACCACCGATATCCAAGGCAATGGTCCAGATCCTGTCTTCGCC

GACATGGGCGCCTCGCTGGTCGACGACGCCAACCCGGTGCAGGACTTC

GCCGCCCATGTGCCCAACATGGCGGGTTTCCACCGCCGCTAG

Pasteurella multocida PMB202 (and recombinant ABA392 gene) protein sequence:

M S L L F C R L S K R V L S W L T S I D Y F L S V A V F F V L S R F S G R T S Y K W P R S I I G L A D T I L I A F H R A Q I R H L L H L R F S A K T R A P S S D R F K P M T K P T G R H R M T Q G P G R W N T A K S E I M T A I A K I S R D C V R D S C P A Y W R I T I G I S G P Q G T V S R A V G R D T R Q P A T Q D S S C D P Q L K Q P A S P D K S P V D I L Y Y H T D H L G T P R E L T D K D A A S S K S R R T R H G V T R R S S G L D D P P I S K A M V Q I L S S P T W A P R W S T T P T R C R T S P P M C P T W R V S T A A

Note: Even if the full gene sequence of 921 bp is analysed using BLAST application, the protein sequence will be somewhat of the same sequence. This shows that only 803bp of all the total of 921bp is involved in transcription and translation of DNA. This can be proven if the above gene sequence with the actual sequence of the ABA392 virulence gene are analysed using BLAST.

Overall Experimental Design

Subcloning into pGEM-T cloning vector

Forward and reverse primers design from PMB202 strain

Gene amplification (PCR) and cloning in pGEM-T vector

Ligation, transformation and sub-culture of E. coli JM109 strain cells

Negative Colony screening (PCR and colony library) Positive

Plasmid isolation

RE digestion (HindIII and Not I)

DNA (Gel) extraction

Subcloning into pVAX1 mammalian vector:

DNA extracted from pGEM-T vector

Digestion of pVAX1 mammalian vector (HindIII and Not I)

Ligation, transformation, and sub-culture in E. coli TOP10 strain cells

Plasmid isolation of recombinant subclone pVAX1 mammalian vector

DNA sequencing and BLAST application

RESULTS AND DISCUSSION

Generally, subcloning of ABA392 gene into the pGEM-T vector and pVAX1 mammalian vector were successfully carried out. This gene of interest was stably maintained in E. coli TOP10 host (competent cells).

The obtained recombinant DNA (ABA392/pVAX1) was extracted and characterised for plasmid analysis (PCR and gel electrophoresis) before sending for DNA sequencing analysis.

The PCR analysis detects the gene of interest in the recombinant mammalian vector. The gel electrophoresis analysis determines the insert size of the recombinant plasmid. The size of the gene insert was estimated about 803bp.

Currently, samples were sent for DNA sequencing to obtain the chromatogram result. The results will be analysed by using BLAST application to match with both the original PMB202 and recombinant ABA392 gene sequences.

4.1 Analysis of colony library of E. coli TOP10

The colony library of E. coli competent cells has the recombinant pVAX1 mammalian vector in it. The current positive colonies that have the recombinant vectors are:

A3, A4, A5, B1, B2, B3, B4, B5, C1, C2, C3, C4, C5, D1, D5, E1, E5, F1, F2, and F6.

Colony Grid

1

2

3

4

5

6

A

O

O

O

B

O

O

O

O

O

C

O

O

O

O

O

D

O

O

E

O

O

F

O

O

O

TABLE 1:

A drawn table showing the presence of positive colonies grown in the LB Petri dish added with Kanamycin

Note: O represents positive colonies

These positive colonies were taken from two LB plates with Kanamycin (one with normal amount of treatment of competent cells, and another with concentrated amount). These colonies could grow because of the insertion of the desired gene fragment which ligated with pVAX1 mammalian vector which already digested with HindIII and NotI and renders the LacZ gene to be ineffective by removing the gene out.

4.2 The features of pVAX1 mammalian vector and its significance

The pVAX1 mammalian vector is an expression vector mainly used for construction of DNA vaccine. The vector is produced and synthesized by Invitrogen, which is the sub-company of Life Technologies based in United States of America (USA). Designed for general immune response, the pVAX1 structure is similar to pUC vector where it has the AUG start codon, the TAA, TAG, or TGA stop codon, a cytomegalovirus (CMV) promoter, and also a translation initiator known as the Kozak sequence (Montgomery & Prather, 2006). According to Montogomery & Prather (2006), the only difference is the between the two vector is the absence of Intron A in the pVAX1 vector. Curretly, pVAX1 vector is commercialised by Invitrogen due to high demand in producing the constructed DNA vaccine based on recombinant mammalian vectors.

The pVAX1 vector is used before against many pathogens such as the recent research to construct DNA vaccine against Mycobacterium tuberculosis (Fauzi, Musa, & Zainuddin, 2009). Based on Fauzi, Musa, & Zainuddin (2009), the comparison between a normal pVAX1 vector and recombinant vector can be done by gel electrophoresis after restriction enzyme digestion, where two bands (one of it represents the actual size of the vector and another is the insert gene) can be found. Without digestion, only one smear-like band will appear and the gene of interest could not be detected. In this case, the samples have to be sending for DNA sequencing for further conformation since there is similar results occur when running gel electrophoresis.

The success of the DNA vaccine construction is important for the future progress of DNA vaccine production that will be tested and may used to treat haemorrhagic septicaemia caused by Pasteurella multocida. As mentioned earlier on (Salmah, 2000; Jamal, 2009), the earlier recombinant plasmids and vectors such as CSI57J, ligated from the ABA392 gene, were found unstable and avirulent in mice after six months. This proves that the insertion of ABA392 gene into these vectors may not be stable in some vectors and thus, have unsuccessful ligation. This in return, causes the insert gene to drop out from the vector. Thus, the successful construction proves that the ABA392 gene insert (Salmah, 2000) is stable in the pVAX1 mammalian vector and can be further use or analyse for DNA vaccine production.

CONCLUSION

Cloning into mammalian vector into E.coli TOP10 host was successfully done and currently the gene insert analysis are in progress.

With this, it is a great hope for the future DNA vaccine research to treat against diseases caused by Pasteurella multocida such as the haemorrhagic septicaemia (Jamal et al, 2005) or any other diseases which related to haemorrhage especially in human.

Therefore, further studies can be carrying out from this constructed recombinant mammalian vector to check its potential as DNA vaccine candidate that can be used against Pasteurella mutocida. It is suggested that this constructed recombinant clone will be used in experimental studies, particularly in animal model via mice to check its immunogenicity, lethality, and effectiveness of the DNA vaccine towards mass production.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.