Compatible Gene Expression System For Rhodobacter Biology Essay


Background: The objective of this research was to develop a BioBrickTM compatible gene expression system for Rhodobacter (R.) sphaeroides. R. sphaeroides is gram-negative, purple non-sulfur, facultative phototrophic anoxygenic proteobacteria. It has the capability of virtually all known biological energy transformations including aerobic respiration, anaerobic photosynthesis, anaerobic respiration and fermentation. These properties could allow R. sphaeroides to be used as a bio-factory or bio-refinery that can utilize solar energy as the energy source and CO2 as the carbon source for the creation of natural bioproducts. In this paper we describe the design of BioBrickTM compatible parts for a gene expression system in R. sphaeroides that includes four constitutive promoters and two lactose inducible promoters, seven Ribosome Binding Sites (RBS), one strong bidirectional terminator, and one cloning vector.

Results: We have successfully constructed four constitutive BioBrickTM promoters BBa_J95023, BBa_J95024, BBa_J95025, and BBa_J95026, and two lactose inducible promoters BBa_J95022 and BBa_J95027. We have also found the consensus sequence of RBS used in R. sphaeroides and converted seven of them into BioBrickTM RBS. They include BBa_J95015 to BBa_J95019, BBa_J95021, and BBa_J95028. To complete the R. sphaeroides operon, we created a strong bidirectional terminator for R. sphaeroides BBa_J95029 and one BioBrickTM compatible cloning vector for R. sphaeroides BBa_J95039.

Lady using a tablet
Lady using a tablet


Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

Conclusions: A solar-powered BioBrickTM compatible gene expression system for R. sphaeroides has been made and demonstrated through expression of fluorescent proteins.


At present, most standard BioBrickTM parts in the Registry of standard biological parts [1] are designed for Escherichia coli (E. coli), although the synthesis of specific BioBrickTM parts for other bacteria, such as yeast [2] and cyanobacteria [3], have already begun. BioBrickTM parts for other bacteria are not complete at the current time. The choice of BioBrickTM chassis is very limited. In this paper, we describe how to extend the BioBrickTM concepts to R. sphaeroides and to the design of a BioBrickTM compatible gene expression system for it.

R. sphaeroides 2.4.1 (ATCC number BAA-808), a gram-negative, purple non-sulfur, facultative phototrophic anoxygenic α-3 subgroup of proteobacteria [4, 5] is capable of virtually all known biological energy transformations [4, 6]. Under aerobic conditions, the organism possesses a typical Gram-negative cell envelop structure and can use aerobic respiration to derive the necessary energy [7]. Anaerobic growth occurs by respiration, photosynthesis, and fermentation. R. sphaeroides can use anoxygenic photosynthesis in the presence of light, anaerobic respiration in the dark using dimethyl sulfoxide (DMSO) or trimethylamine-N-Oxide (TMAO) as an alternative electron acceptor [37,38], or fermentation with appropriate substrates when oxygen is not available. When growing photosynthetically, its absorption maximum is in the near infra-red and its reaction center is believed to be the ancestor of plant photosystem II [8].

R. sphaeroides also has some special metabolic capabilities, such as dinitrogen fixation, autotropical capability in the presence of H2 and single-carbon compounds (CO2 or methanol), and detoxification of metal oxides and oxyanions [6, 9]. Organic compounds are used as both a source of carbon and reductant for photoheterotrophic and chemoheterotrohpic growth, with CO2 being used as the sole carbon source under autotrophic growth conditions. Hydrogen can be used as the source of reducing power for photoautotrophic or chemoautotrophic growth [10]. R. sphaeroides 2.4.1 can also utilize dinitrogen as the sole source of nitrogen [5].

R. sphaeroides operonic structure is different from that of E. coli. It has RNA polymerase holoenzymes (Eσ93 and Eσ37) that are different from E. coli Eσ70 and Eσ32, respectively [11]. In addition, there must be significant differences in promoter specificity, because a native ribosome RNA operon promoter (rrnB) recognized by R. sphaeroides Eσ93 is not transcribed by E coli Eσ70[11].

In addition, mannitol dehydrogenase, which is generally utilized for biotechnological applications [39], can be expressed both in E. coli and in R. sphaeroides. However, its' specific activity through expression in R. sphaeroides is much higher than in E. coli [40]. Therefore, R. sphaeroides can be another choice for proteins that cannot be expressed in E. coli.

Our primary objective of this research is to convert R. sphaeroides into a potential solar powered microbial 'bio-factory' or 'bio-refinery' that can use CO2 as their primary carbon source for the creation of natural bioproducts. To fulfill this objective, we needed to design a gene expression system that can be used to synthesize useful bioproducts inside R. sphaeroides. We also want this gene expression system to be BioBrickTM compatible so that DNA assembly process for gene expression in R. sphaeroides is faster and easier.

Cloning Vectors for R. sphaeroides

Lady using a tablet
Lady using a tablet


Writing Services

Lady Using Tablet

Always on Time

Marked to Standard

Order Now

Several cloning vectors, such as plasmid R1822, and RP4, have been used to transform DNA either from Pseudomonas (P.) aeruginosa (R1822)[14], or from E. coli (RP4)[15] to R. sphaeroides. Broad host vectors like RSF1010 [16], pRK415, pR388 and its derivatives cosmid cloning vector pPSX [17] have also been used to transfer DNA either from E. coli to photosynthetic bacteria or among different photosynthetic bacteria [17] . However, all of these cloning vectors cannot be stably maintained in R. sphaeroides in the absence of antibiotic selection, although cosmid vector pPSK demonstrates high levels of segregational stability in E. coli K12 [17].

The segregational instability of plasmids is a potential problem for synthesis of useful bio-products inside R. sphaeroides. Certain sensors that are used to monitor the concentration of antibiotic may be required in order to maintain the plasmids inside the cell. However, the monitor system not only makes the equipment clumsy but also increases the cost of maintaining such a system. Therefore, a stable gene expression system is needed for R. sphaeroides-based bio-manufacturing.

Inui has purified a plasmid from Rhodobacter blasticus [18]. This plasmid is named pMG160 and has a size of 3.4 kb. It can be used as a shuttle vector from E. coli to R. sphaeroides through diparental conjugation with E. coli S17-1 as the plasmid donor or tri-parental conjugation with E. coli HB101/PRK2013 as the helper and E. coli DH5αPhe or one Shot top10 as the plasmid donor. The E. coli donors contain chromosomal copies of the trans-acting elements that mobilize oriT-containing plasmids. The complete nucleotide composition of pMG160 has been sequenced and can be accessed through the website at

Plasmids pMG160 can be transformed into R. sphaeroides, R. capsulatus, and R. palustris through conjugation [18]. Based on plasmid pMG160, two 6.1-kb E. coli - R. sphaeroides cloning vectors have been constructed and named pMG170 and pMG171, respectively [18]. These two vectors were able to replicate in R. sphaeroides and can be stably maintained in R. sphaeroides without selective pressure. The copy number of pMG170/pMG171 per chromosome in R. sphaeroides is from 18 to 23.

Promoters for R. sphaeroides

DNA-dependent RNA polymerase (RNAP) is the critical enzyme for transcription and gene expressions in all living organisms. R. sphaeroides RNAP was able to generate transcripts from the pufQ and pufB promoter regions [19]. However, it is not clear what form of R. sphaeroides RNAP holoenzyme was responsible for synthesizing these products since the pufQ and pufB control regions do not bear a strong resemblance to any known prokaryotic promoters [20].

R. sphaeroides has separate RNAP holoenzymes (Eσ93 and Eσ37) that recognize E. coli Eσ70- and Eσ32-dependent promoters, respectively. In addition, the major σ and core subunits of the E. coli and R. sphaeroides enzymes are sufficiently compatible to allow for promoter recognition by heterologous enzymes containing core from one bacterium and sigma from the second [20]. R. sphaeroides RNAP recognized several cloned σ70-dependent promoters, including lacUV5, Tn903kan, rrnB P1, and the plasmid origin of replication inhibition promoter P4 (oriV). All of these promoters have -10 and -35 hexamers with considerable homology to the σ70 consensus sequence and differ from the optimal 17-bp spacing between these elements by at most 1 bp [20]. Despite this overall similarity, there appears to be significant differences in promoter specificity, since all three native ribosome RNA operon promoters recognized by R. sphaeroides Eσ93 are not transcribed by E. coli Eσ70[20].

Ribosome Binding Sites (RBS) for Rhodobacter sphaeroides

The registry of standard biological parts [1] has a few collections of RBSs, including Anderson RBS family [21], the community collection [22], Isaacs RBS family [23], and Rackham RBS family [24], all designed for E. coli. These RBSs have not been tested on other bacteria. The intrinsic RBS or the Shine-Dalgarno sequence [28] that work in R. sphaeroides are not currently published or available in the refereed literature at the present time.

Terminator for Rhodobacter sphaeroides

There is a large terminator database in the Registry of standard biological parts [1]. All of these terminators are ρ-independent and they are designed for E. coli. Testing of these terminators on other prokaryotic bacteria has not been reported in the referred literature. Omega cartridge, a 2.0-kb DNA segment which consists of a streptomycin-spectinomycin antibiotic resistance gene flanked by short inverted repeats carrying transcription and translation termination signals [25], have been used to prevent transcription from random vector sequences upstream of the promoter fusion sequences in pHP45 vector in R. sphaeroides [26]. Because of the symmetrical structure of Omega terminator, this terminator works in either direction.


BioBrick vectors for R. sphaeroides

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

We have successfully converted cloning vector pMG170/pMG171 to standard BioBrickTM compatible vector BBa_J95039. Both lacZ promoter and reporter in cloning vector pMg170/pMG171 have also been removed in this newly constructed cloning vector BBa_J95039 (shown in Figure 1).

BioBrickTM promoters for R. sphaeroides

We have successfully designed and tested four constitutive BioBrick promoters (BBa_J95023, BBa_J95024, BBa_J95025, and BBa_J95026) and two composite lactose inducible promoters (BBa_J95022 and BBa_J95027). The constitutive promoters are based on the rRNA operon structure of Rhodobacter sphaeroides [26]. BBa_J95022 is a composite promoter based on promoter PA1/04 and PA1/03 [13]. Promoter BBa_J95027 is a composite promoter and are based on rrnB operon [26] and lac operon [13]. The structures of promoters BBa_J95022, BBa_J95025, BBa_J95026, and BBa_J95027 are given in Figure 2. All these promoters' sequences can be accessed through Registry of Biological parts [1].

BioBrickTM Ribosome Binding Site (RBS) for Rhodobacter sphaeroides

In order to design a BioBrickTM RBS, we must understand its intrinsic characteristics in R. sphaeroides. Sequence logo method [27] can be used to find the RBS consensus sequence in R. sphaeroides. Since the RBS is generally located 6-7 nucleotides upstream of the start codon of AUG [28], we can create a training set with the complete sequence of R. sphaeroides to find the consensus sequence used in R. sphaeroides.

The whole genome of R. sphaeroides 2.4.1 can be accessed through the DOE Joint Genome Institute ( Genes exporting format use FASTA Nucleic Acid format. -18 bp upstream and +0 bp downstream option have also been used for each gene to identify the DNA. In order to generate the Ribosome Binding Set (RBS) training set, unnecessary nucleotides have been removed to get the following form CTCGATCGGATCCGTTTCATGGCCATT, where ATG is the start codon. The final RBS training set is composed of 4302 DNA sequences in the same form. The R. sphaeroides sequence logo is created with the UC Berkeley free online WebLogo software [41] and is shown in Figure 3.

Figure 3 shows the R. sphaeroides 2.4.1 RBS consensus sequence is CC-G-GGGGGGG-G-GCC, which is different from that of E. coli RBS AA-AAAGGGGAT-AATA [27]. In addition, the GGAGG sequence has been reported as an effective RBS in R. sphaeroides and has been successfully used to express a rat gene in R. sphaeroides [29]. We have studied the training set and found GGAGG sequences are highly conserved in these upstream sequences and are mainly located 4 to 10 bases away from the start codon ATG. The analysis results of GGAGG distributions upstream of R. sphaeroides genes are shown in Figure 4.

Based on these findings, BioBrickTM compatible RBS with different activities have been constructed for R. sphaeroides and are shown in Table 1.

BioBrickTM terminator for R. sphaeroides

We have designed a standard BioBrickTM bidirectional terminator-Omega terminator (BBa_J95029), which is based on the omega cartridge [25]. In order to decrease the size of the final plasmid, the streptomycin-spectinomycin resistance gene has been removed from the streptomycin-spectinomycin omega cartridge. The sequence for this omega terminator can be accessed through the Registry of Biological parts [1].

Expression of Cyan Fluorescent Protein (CFP) in R. sphaeroides

The synthesis of CFP with promoter BBa_J95025 and ribosome binding site BBa_J95021 was studied. One novel polypeptide with apparent molecular mass of 27 kDa was synthesized from plasmids BBa_JJ95039 (Figure 5). The data obtained indicate that this protein is encoded by BBa_E0020, since this would encode a protein with a predicted molecular mass of 26901 Da. To confirm this analysis, the polypeptide shown in the SDS-PAGE was cut and sent to Alphalyse Company for mass spectrometry (protein identification) and the result confirmed our analysis.

Gene expression system test with fluorescent proteins

Other promoters and ribosome binding sites have also been tested with fluorescent proteins and their structures and fluorescent pictures are shown in Figure 6. For lactose inducible promoters (BBa_J95022 and BBa_J95027), R. sphaeroides cells were grown aerobically in Sistrom medium [34] without IPTG until the optical density at 700 nm reached at 0.3, IPTG was then added with a final concentration 1 mM. All of pictures shown in Figure 6 were taken with an Olympus IX81 fluorescent microscope at 100 ms exposure and pixels bin factor 2x2.

Figure 5 and Figure 6 shows our BioBrickTM compatible gene expression system for R. sphaeroides works. These BioBrickTM parts have been characterized using the Bioluminescence-based method [42] and their relative activities and the termination efficiency will be provided in another paper [43].


The current work initially aimed to provide a well-defined, easy to control, and flexible BioBrick compatible gene expression system for R. sphaeroides. All of the BioBrick parts include promoters, RBSs, and terminators, have been proved to be functional inside R. sphaeroides. Hence, this gene expression system provides a powerful tool that can convert solar energy and CO2 to useful bioproducts in R. sphaeroides.


We have designed a complete gene expression system, which includes promoters, RBS, and one terminator for R. sphaeroides. We can control gene expression with different combinations of promoters and RBSs. To our knowledge, this is the first attempt to design a complete BioBrickTM compatible gene expression system for R. sphaeroides.


Bacterial strains and plasmids

Bacterial strains and plasmids used in this study are presented in Table 2.

Culture conditions

E. coli strains were grown aerobically at 37oC in Luria-Bertani medium [33]. R. sphaeroides 2.4.1 were cultivated at 30oC in Sistrom's minimal medium [34]. When appropriate, media were supplemented with the following antibiotics. For E. coli and R. sphaeroides, kanamycin was used at a final concentration of 50 µg/ml.

DNA techniques

Plasmids DNA was purified from the cell with QIAGEN QIAprep Spin Miniprep Kit (catalog ID# 27106 or 27104). Restriction endonucleases including EcoRI, XbaI, SpeI, and PstI were obtained from New England biolab. Rapid DNA ligation kit was ordered from Fermentas. E. coli S17-1 strains were transformed by the CaCl2 method [33]. R. sphaeroides 2.4.1 was transformed through di-parental spot mating with E. coli S17-1 as the plasmid donor [6], or tri-parental mating method where the conjugal plasmid pRK2013 in E. coli HB101 were used as a helper [35] and E. coli DH5αPhe or One-Shot Top10 cells were used as the plasmids donor. Restriction fragments were isolated and purified, when required, from agarose gels with QIAGEN QIAquick gel extraction kit (catalog # 28704 or 28706).

QuikChange lightning site-directed mutagenesis kit (catalog #210518) used to convert cloning vector pMG170/pMG171 to standard BioBrickTM vectors BBa_J95039 was achieved through Stratagene Company. To convert cloning vector pMG170/pMG171 to a standard BioBrickTM compatible vector, two steps are required. The first step is to delete the Lac promoter and reporter from cloning vector pMG170/pMG171 in order to make the new vector more flexible. We created an inter-vector that does not contain the lac promoter and reporter using the oligoucleotide primers P1 GCGGCTTTGTTGAATAAATCGCGAACTTTTGCTGAGTTGAAG and P2 CTTCAACTCAGCAAAAGTTCGCGATTTATTCAACAAAGCCGC.

To convert the inter-vector to a standard BioBrickTM vector, BioBrickTM prefix and suffix is required. Therefore, the second step is to insert BioBrickTM prefix and suffix in the inter-vector. To improve the efficiency of insertion, we only insert EcoRI (part of prefix) and PstI (part of suffix) using oligonucleotide primers P3 GCGGCTTTGTTGAATAAATCGGAATTCGCGGCCGCCTGCAGCGAACTTTTGCTGAGTTGAAG, P4 CTTCAACTCAGCAAAAGTTCGCTGCAGGCGGCCGCGAATTCCGATTTATTCAACAAAGCCGC to make a BioBrickTM vector BBa_J95039 (EcoRI and PstI restriction sites only). To convert vectors BBa_J95039 to standard BioBrickTM style, we double digested them and an arbitrary BioBrickTM part that you need with restriction enzymes EcoRI and PstI and then ligate the double digested vector and the BioBrickTM part.

All BioBrickTM RBS and lactose inducible promoters were ordered through Integrated DNA Technologies Company (www. Other oligonucleotide primers that were used to construct BioBrickTM promoters BBa_J95023, BBa_J95025, BBa_J95024, and used to construct BioBrickTM Omega terminator BBa_J95029 for R. sphaeroides are listed in Table 3.

Competing interests

The authors declare that they have no competing interests.

Author's contributions

HSH, RCS, and JH conceived of this study. JH designed, conducted all experiments, and wrote the manuscript. All authors read and approved the final manuscript.


The authors would like to thank Samuel Kaplan, Jesus Eraso, and Masayuki Inui for providing the E. coli strain S17-1, HB101/pRK2013, R. sphaeroides strain 2.4.1, plasmids JE379/JE380, conjugation protocols, and plasmids pMG170/pMG171, respectively. The authors would also like to thank the USTAR Synthetic Bio-manufacturing center (SBC) [36] at Utah State University (USU) and the Utah Science Technology and Research initiative (USTAR) [12] at USU for their financial support.