Common Fungal Agents Related With Onychomycosis Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Most common and applied way of identifying these fungi is in vitro culture method and study of macroscopic (colony shape, size, colour etc.) and microscopic (spore shape, size, arrangement etc.) characters as well as some biochemical and physiological tests. These conventional methods for the identification of fungi are time consuming and require a significant degree of knowledge and technological expertise. These classical approach for identification is difficult due to high similarity between dermatophytes and also their pleomorphic (organism having more than one life form) character delimits the specific identification.

In recent years molecular approaches have been developed for the identification of fungi related with onychomycosis. Many investigators have focused their research on nucleic acids of dermatophytes. Molecular identification has been primarily based on techniques such as AP-PCR, PCR-RFLP analysis, GC content based, Sequence of rDNA (which codes for rRNA), mtDNA based etc. These all techniques are based on simple Polymerase Chain Reaction (PCR). Techniques based on sequence analysis of rDNA regions such as ITS1, ITS2, NTS, 18s rDNA (small subunit) & 28s rDNA (large subunit) have been most efficient in identification.

rDNA sequence analysis is an appropriate way of identifying fungi as rDNA sequences have conserved regions which are highly species specific and varies in closely related species as well. ITS (Internal Transcribed Spacer) have been mostly studied region for identification of filamentous fungi [9, 10, 11, 12]. ITS region in rDNA has polymorphic nucleotides repeat which is species specific. Similarly 28s rDNA sequence also have species specific nucleotide sequence which can be used to identify fungal species.

Objective of this study

Objective of this study was to isolate fungi from infected nails and identify isolated fungi up to strain level by characterizing their gDNA (genomic DNA) sequences. In this study two sets of degenerate, universal primers targeting both the ITS region along with 5.8s rDNA; and 28s rDNA have been used to PCR amplify short sequences to generate their sequence and align them with previously known homologous sequences in public (BLAST) database to identify the fungal species.

Reasons for targeting rDNA sequence:

Eukaryotic DNA has more than a single copy of rDNA on different chromosomes so lesser genomic DNA is sufficient for PCR as primers have many sites for annealing.

rDNA have species specific sequences.

REVIEW OF LITERATURE

Dermatophytes (Greek; Skin Plants) are group of closely related Mitosporic (asexually reproducing) fungi that can invades keratinized tissue of Humans and animal (skin, hairs & nails) and causes Dermatophytosis, commonly referred to as ringworm or tinea [13]. These are keratinophilic and keratinolytic fungi that have high affinity for keratinized tissue; these fungi are soil fungi which degrade keratinized material. Infection is generally superficial or cutaneous and limited to nonliving keratinized layers in healthy host. These infections are common and not life threatening disease. Indeed, except in some rare cases of "Hadida and Schousboe¨'s dermatophytic disease [14].

The etiologic agents of the dermatophytosis are classified in Three anamorphic (asexual or imperfect) genera, Epidermophyton, Microsporum, and Trichophyton, of anamorphic class Hyphomycetes of Deuteromycota (Fungi Imperfecti) Classification of these fungi is based on morphology given by Emmons [15].

There are about 40 species in these three genera. Species capable of reproducing sexually belongs in telomorphic (sexual) genus Arthroderma, of the Ascomycota. Fungi whose anamorph and teomorph stages are known are known by two different species name. Anamorph stage is found on living host and the other state (perfect state) is found in environment. Especially species of Trichophyton and Microsporum are known to have perfect state.

Dermatophytes can generally be classified into three classes-

Geophilic: These are soil fungi that degrade keratinized material (skin, hair, feather, nails, horns etc.) in environment and rarely cause infection to human or animal.

Zoophilic: These organisms are found primarily on animals and causes marked inflammatory reactions in human who comes in contact with infected animals but this is rare and easily terminated.

Anthropophilic: These are restricted to human host and vary rarely cause infection in animals. Infection in humans is restricted to cutaneous layer of epidermis.

Dermatophytes are group of fungi which grow best in warm and humid environment, therefore, common in tropical and subtropical regions. Dermatophytes are highly adapted human pathogens which are very much similar in their phenotypic behaviour and morphological characters. Closely biologically related organisms not included in Dermatophytes Chrysosporium species with telomorphs in genus Arthroderma [1].

Some commonly known Dermatophytes are Trichophyton rubrum [most frequently (58%) isolated], Trichophyton mentagrophytes (27%),Trichophyton verrucosum (7%),Trichophyton tonsurans (3%),Infrequently isolated (less than 1%) are Epidermophyton floccosum, Microsporum audouinii, Microsporum canis, Microsporum equinum, Microsporum nanum, Microsporum versicolor, Trichophyton equinum, Trichophyton kanei, Trichophyton raubitschekii, and Trichophyton violaceum.Some non dermatophytic moulds and yeast are also related with skin diseases which is known as Dermatomycosis e.g. Aspergillus spp., Fusarium spp., Scytalidium spp., Candida spp. Etc.

Dermatophytosis is the most common superficial infection in the world; it is also the most common fungal infection. In humans infection occurs by contact with arthrospores (asexual spores formed in the hyphae of the parasitic stage) or conidia (sexual or asexual spores formed in the "free living" environmental stage). Infection usually begins in a growing hair or the stratum corneum (outermost layer of epidermis) of the skin. Dermatophytes do not generally invade resting hairs, since the essential nutrients they need for growth are absent or limited. Hyphae spread in the hairs and keratinized skin and eventually developing infectious arthrospores. These are not true parasites as they don't infect living tissues [16].

Dermatophytes generally grow only in keratinized tissues such as hair, nails and the outer layer of skin; the fungus usually stops spreading where it contacts living cells or areas of inflammation. Mucus membranes are not affected. The clinical signs may vary, depending on the region affected. In humans, pruritus is the most common symptom. The skin lesions are usually characterized by inflammation that is most severe at the edges, with erythema, scaling and occasionally blister formation. Central clearing is sometimes seen, particularly in tinea corporis; this results in the formation of a classic, "ringworm" lesion. On the scalp and facial hair, there may be hair loss. Dermatophytes acquired from animals or the soil generally produce more inflammatory lesions in humans than anthropophilic dermatophytes. In humans, dermatophytosis is referred to as "tinea" infections, and is named with reference to the area of the body involved. Infections can spread to other areas; tinea corporis in children, for example, is often the result of a tinea capitis infection that has spread to the face [16]. Various types of tinea have been shown in table 1.

Types of tinea

Name

Infected organ

causal organism

symptoms

Tinea Barbae

Beard (Face)

Trichophyton verrucosum,

T. mentagrophytes var.

mentagrophytes, and T. mentagrophytes var. erinacei

Mild and superficial or a severe inflammatory pustular folliculitis.

Tinea Capitis

Scalp (Skin) & Hair

Microsporum spp.,

Trichophyton spp.,

T. tonsurans

slight erythema, patchy areas of scaling with dull gray hair, kerion formation, sometimes accompanied by fever

Tinea Corporis

trunk, shoulders, or limbs, occasionally the face (excluding the bearded area)

T. rubrum, M. canis, M. tonsurans,

T. verrucosum or any other dermatophyte

Ringworm of the body, annular, scaly patches

Tinea Cruris (''Jock Itch'')

Groin or perianal, and perineal areas, occasionally the upper thighs

T. rubrum and E. floccosum

Lesions are erythematous to tawny brown ,dry scales, burning and pruritus

Tinea Manuum

Palmer and interdigital areas of hand

T. rubrum

Diffusely dry, scaly palm

Tinea Pedis (''Athlete's Foot'')

Feet especially toe webs and soles

T. mentagrophytes.

T. rubrum,

T. mentagrophytes var. interdigitale, and

E. floccosum

fissures, scales and maceration in the toe

web

Tinea Unguium ("Onychomycosis")

Nails

T. rubrum and

T. mentagrophytes

E. floccosum

thickened, discolored, broken and dystrophic

nails, sometimes nail plate is separated from nail bed

Onychomycosis

Onychomycosis traditionally referred to a nondermatophytic infection of the nail but is now used as a general term to denote any fungal nail infection [1]; Tinea Unguium specifically describes dermatophytic nail infection of hand or toe. Now Onychomycosis is referred to as nail infection caused by fungi; many dermatophytic and nondermatophytic fungi are associated with nail infections.

Onychomycosis is more common in men then in women and percentage of occurrence increases with age. Onychomycosis is not a major disease as it is not lethal but subsequent treatment is necessary to prevent repeated skin infections. Dermatophytes accounts for most (90%) cases of Onychomycosis of toenails and (50%) of fingernails [17]. Toenails are 25 times more likely then fingernails to get infected as they bear a lot of pressure and trauma from footwear. Role of nondermatophytic molds in infection is not clearly known, because they may be colonizing organism rather than infectious agents; however moulds and yeasts have been reported as sole infectious agents in 1.5-6% cases of Onychomycosis [18, 19].

Onychomycosis affects different parts of nail unit (figure 1); four types of Onychomycosis, characterized according to clinical presentation and route of invasion, are recognized and listed below.

Fig. 1 Anatomy of nail showing different nails units

Distal Subungual Onychomycosis [DSO]:

This is the most common type of Onychomycosis and characterized by infection of nail bed and lower layer of nail plate near the hyponychium. This result in mild inflammation, detachment of nail plate, thickening of subungual region and providing opportunity to moulds and bacteria for superinfection giving nail a yellowish brown colour. This is usually caused by T. rubrum [20, 21], although T. mentagrophytes, T. tonsurans, and E. floccosum are also known as causative agents.

Proximal Subungual Onychomycosis [PSO]:

Also known as Proximal White Subungual Onychomycosis [PWSO], this is uncommon because nail is invaded via proximal nail fold through cuticle area (are from which nail originates). This infection destroys proximal nail plate and detaches complete nail, this is rarest form of Onychomycosis only occurs in immune compromised patients such as AIDS patients [22]. T. rubrum is the only agent known to cause PSO [23].

White Superficial Onychomycosis [WSO]:

WSO is less common than DSO (10% of all cases) [24] and occurs when fungi directly invades superficial layer of nail plate which may later invade nail bed and hyponychium. It is characterized by presence of opaque white patch on external nail plate; nail becomes rough, soft and crumbly [25]. This primarily affects toenails and commonly caused by T. mentagrophytes, several nondermatophytic moulds such as Aspergillus terreus, Acremonium roseogrisum and Fusarium oxysporum are also known to cause WSO [24].

Candida Infections of the Nail:

Candida infection of the nail occurs in patients with chronic mucocutaneous candidiasis caused by Candida albicans [26]; organism invades the entire nail plate. This is more common in women than in men; organism invades in three phases- it infects the surrounding of nail plate (most common) [27]; then infects the nail plate [28] and finally separates the nail plate from nail bed. Second and third phases are rare and only occur in severe cases [27].

Identification of etiological agent of onychomycosis

Conventional methods:

Conventional methods for identifying fungi related with onychomycosis include proper diagnosis of nail infection because several other diseases mimic the clinical symptoms of onychomycosis like psoriasis (the most common such disorder), lichen planus, bacterial infections, contact dermatitis, traumatic onychodystrophies, pachyonychia congenita, nail bed tumours, yellow-nail syndrome (rare), and idiopathic onycholysis [8]. The clinical presentation of dystrophic nail is a possibility of onychomycosis; however, because fungi cause only about 30% of all nail dystrophies [28]. Use of appropriate diagnosis method which include direct microscopy, histopathology, patients history record, and in vitro culture method also some physiological and biochemical tests is required to confirm fungal infection [1, 29, 30].

Direct microscopy of clinical specimen is the first step and screening method for fungal infection in which infected nail is directly examined under microscope in presence of any clearing agent like 20-25% KOH or NaOH with either glycerol (5%) or DMSO (36%) [1, 30]. If fungal hyphae are visible by direct microscopy, than it is estimated that infection might be caused by fungi. Further identification requires isolation of fungi onto a culture medium for phenotypic studies.

Culture:

Culture is the only method by which causative microorganism can be identified. Caution is required for analyzing culture results, because nails are nonsterile and fungal or bacterial contaminants may obscure the pathogen [1]. Specimen is (should be) plated on two different media: a primary medium which is selective for dermatophytic fungi and a secondary medium which allows such growth. Cycloheximide is an antifungal drug which is incorporated in primary medium to inhibit nondermatophytic mould's growth. If growth occurs on both media then the infective agent is probably a dermatophyte, whereas growth only on cycloheximide free medium indicates nondermatophytic infectious agent, however it is not confirmed that nondermatophytic fungi is causing disease [1, 8, 29, 30, 31, 32]. Repeated isolation can account for nondermatophytic contaminations, if the same organism is isolated repeatedly than it can be estimated that this is the infecting agent.

Culture can be done on agar plates or slants and inoculation is done by planting pieces of infected nails on to media surface. Generally 7-10 days of incubation at 25⁰-30⁰ C is given, visible growth (fungal colony) is observed for macro morphology which includes colony shape, size, texture, colour etc., confirmatory identification is based on microscopy. Microscopic analysis of fungi is done to estimate the exact species by observing its spore structure, size, shape, arrangement. This method for identification is very tedious and sometimes inappropriate, because members of group of dermatophytes are homogeneous with respect to appearance, physiology, taxonomy, antigenicity, basic growth requirements, infectivity, and the diseases they cause [33]. Pleomorphism is also a barrier in identification.

Molecular identification:

Recent advances in molecular biology have solved problems concerning morphological identification and have improved our knowledge on the epidemiology of dermatophytes. Several molecular biology based techniques have been developed to identify fungi. Most studied region for their identification is ITS region in rDNA [9, 10, 11, 12, 34, 36].

Fungal (eukaryotic) rDNA has multiple copies of rRNA coding genes which are arranged in "Head-to-Tail" tandem repeats also called "direct repeats". rDNA contains repetitive transcriptional units involving 18S, 5.5S, and 28S rRNAs, two transcribed intergenic spacers ITS1 and ITS2 and two external spacer sequences (5´and 3´ ETS). These units are transcribed by RNA polymerase I and separated by non-transcribed intergenic spacers (IGS) as represented on Figure 2.

The product of RNA polymerase I is processed in the nucleolus, where ITS1 and ITS2 are excised and three types of rRNAs produced. The ITS regions have important biological meaning in rRNA processing. They form specific secondary structures they are needed for correct recognition of cleavage sites and provide the binding

sites for nucleolar proteins and RNAs during ribosome maturation .The available data on rRNA structures show that rRNA processing is conserved process. The structures of analyzed ITS2 and ITS2

contain four or three helical arms [1, 10]. The changes in size and sequence of these regions are then biologically permissible as long as they do not disturb the formation of secondary structures which facilitate the rRNA processing [35].

Fig. 2 Schematic representation of rDNA region, ITS=internal transcribed spacers, ETS=external transcribed spacers, IGS = non-transcribed intergenic spacers [35]

Similarly large sub unit rDNA (28s rDNA) has been a target for sequence analysis and fungi identification [37, 38]. 28s rDNA is a conserved sequence which is later transcribed into 28s rRNA and further translated into a unit of a ribosome, hence LSU sequence is preserved from instant mutations. ITS region is a nonfunctional sequence (intron) and has high degree of variation in sequence even in between closely related strains; although this is more vulnerable for sudden mutations which can occur if isolate is being continuously restreaked, this can result in sequence differentiation between same strain. LSU sequences would be more accurate for genotypic identification as lesser degree of variation between similar strains will be present.

Materials and methods

Sample collection:

Infected nail samples were provided by Dermatology unit of Ram Manohar Lohia Hospital New Delhi. Collection & primary treatment of samples was performed by the doctor in charge of dermatology unit. Infected nail's scrapings were collected in sterile 1.5 ml vials in PBS (phosphate buffer saline) solution. Information of patient like name, gender, age, and treatment history was noted on a notebook along with weight of sample.

Isolation of fungi from samples:

2.1 Media preparation:

Four types of media were used for primary isolation from nail samples.

[1] SCC media- Synthetic media (Himedia) with Cycloheximide and Chloramphenicol.

[2] SCC (+) media- Sabouraud dextrose agar (Himedia) supplemented with Cycloheximide and Chloramphenicol after autoclaving.

[3] PDA+amp+tet media- Potato dextrose agar (Himedia) supplemented with Ampicillin and tetracycline after autoclaving.

[4] SDA+amp+tet+chl media- SDA (Himedia) supplemented with ampicillin, tetracycline and chloramphenicol after autoclaving.

Working concentrations of antibiotics:

Ampicillin- 100µg/ml from 100mg/ml stock

Chloramphenicol- 50µg/ml from 25mg/ml stock

Cycloheximide- 500µg/ml from 25mg/ml stock

Tetracycline- 20µg/ml from 20mg/ml stock

2.2 Inoculum preparation and inoculation:

Nail samples were washed with 10x antibiotic solution of ampicillin and placed in a sterile petri dish.

Samples were drenched with 500µl of SD broth (Himedia) or autoclaved distilled water and nails were crushed into fragments with the help of scalpel blade.

100 µl of SD broth in which nail had been fragmented was spread over different media plates with spreader.

Nail fragments were used as inoculum as these were stabbed into agar plates.

Plates were incubated at 30⁰C for 7-10 days.

2.3 Pure culture preparation:

When visible fugal growth was obtained on spread and stab plates colonies with different morphology were picked and point inoculated onto media with Cycloheximide [either SCC or SCC (+)]

Once growth was confirmed on Cycloheximide media subcultures were done on SCC, SCC (+), SDA and PDA plates to study growth rates, pigmentation and macro morphology.

2.4 Selective medium test [39, 40, 41]:

Dermatophyte test medium was prepared by adding pH indicator Phenol Red in SCC medium (0.2 g/l).

Fungal culture was inoculated on test medium and incubated at 30⁰C for one week.

Genomic DNA isolation:

Genomic DNA was isolated by using fungal hyphae which were scraped from agar plates and using beads beating method of gDNA isolation [42].

Beads beating protocol:-

200-500 mg of mycelium (wet weight) was added to 1.5 ml microcentrifuge tubes.

500 µl of beads beating solution [0.1 M NaCl, 0.5 M Tris HCl (pH 8.0), 5% Sodium Dodecyl Sulphate] was added and approximately 0.2 g of mixed diameter glass beads was also added.

Mycelia were homogenized with sterile micropestle and tubes were then placed into a TurboMixâ„¢ adapter (Scientific Industries, INC.) attachment for a Vortex Genie 2 (Fisher Bioblock Scientific) and homogenized for 10 min at maximum speed.

Tubes were than centrifuged at 11,000 g for 10 min and supernatants were transferred into new tubes and extraction procedure was repeated.

An equal volume of Phenol: chloroform: isoamyl alcohol (25:24:1) was added to each sample and mixed by inverting tubes gently.

Tubes were centrifuged at 11,000 g for 10 min and upper aqueous layer was transferred into new tubes.

An equal amount of chloroform: isoamyl alcohol (24:1) was added and mixed gently and again centrifuged at 11,000 g for 5 min.

Upper aqueous layer was transferred into new tubes and approximately 2.5 volumes of isopropanol was added and mixed by inverting, tubes were kept in -20⁰C for 30 min for DNA precipitation.

Tubes were centrifuged at 14,000 g for 10 min at 4⁰C and supernatant was discarded.

Pallets were washed twice with 70% ethanol, air dried and then resuspended in 50 µl of TE buffer [10mM tris HCl (pH 8.0), 1mM EDTA (pH 8.0)]

DNA yields and quality was assessed by electrophoresis through 0.8% (w/v) Agarose gel.

Polymerase chain reaction:

4.1 Amplification of 28s rDNA:-

Amplification of 28s rDNA gene was done by using large subunit (LSU) primers to amplify a portion of 28s rDNA [37]. Standard PCR reaction was carried out as follows.

50 ng of gDNA, 2 µM of each sense and antisense oligonucleotidde (20 µM), 200 µM of dNTP mix (10 mM each dNTP), 1x PCR buffer were mixed in deionised water to give final volume of 50 µl, 2.5 U of Taq Polymerase (Banglore Genie) was added to per reaction and reaction was proceeded by incubating reaction mix at 94⁰C for 1 min, followed by repeated 40 cycles of 94⁰C for 30 sec, 55⁰C for 30 sec, 72⁰C for 30 sec, with a final extension of 72⁰C for 10 min and a 4⁰C hold for indefinite time. Amplified products were checked on 1.2% (w/v) Agarose gel.

Optimized PCR for 28s rDNA amplification:

In this study PCR mix and reaction conditions were modified after several optimization steps. Changes that were made to standard mix are addition of extra MgCl₂ to the final concentration of 3mM, addition of DMSO (Di-methyl Sulfoxide) to the final concentration of 5% and reduction of oligonucleotidde concentration to 0.5 µM for each forward and reverse primer. Annealing temperature was also optimised to 54.7⁰C.

Primer details-

Primer

Sequence (5'→3')

Fragment size

LSU 1 (FP)

GATAGCGMACAAGTAGAGTG

310-314

LSU 2 (RP)

GTCCGTGTTTCAAGACGGG

−

4.2 Amplification of ITS 1, 5.8s rDNA and ITS 2 region:-

Amplification of both ITS region along with 5.8s rDNA was done by using ITS 1-F and ITS 4 primers (figure 3) [43].

Fig. 3 Diagram of primer locations in the ribosomal cassette consisting of SSU, ITS1, 5.8S, ITS2, and LSU rDNA. Scale is in base pairs according to the extension of the Gargas and DePriest [44] nomenclature system.

Primer details-

Primer

Sequence (5'→3')

Fragment size

ITS 1-F (FP)

CTTGGTCATTTAGAGGAAGTAA

600-700

ITS 4 (RP)

TCCTCCGCTTATTGATATGC

−

PCR for amplification of both ITS and 5.8s rDNA was carried out as follows.

50 ng of gDNA, 2 µM of each sense and antisense oligonucleotidde (20 µM), 200 µM of dNTP mix (10 mM each dNTP), 1x PCR buffer were mixed in deionised water to give final volume of 50 µl, 2.5 U of Taq Polymerase (Banglore Genie) was added to per reaction and reaction was proceeded by incubating reaction mix at 95⁰C for 95 sec, followed by repeated 35 cycles of 94⁰C for 30 sec, 52⁰C for 40 sec, 72⁰C for 2 min, with a final extension of 72⁰C for 10 min and a 4⁰C hold for indefinite time [45]. Amplified products were checked on 1.2% (w/v) Agarose gel.

4.3 Gel elution of amplified products:-

Amplified products were electrophoresed through 1.2% (w/v) agarose gel stained with ethidium bromide with 1Kb DNA ladder (Gene rulerâ„¢ 1kb ladder Fermentas).

After the run bands were visualized in 312nm UV light and with the help of sterile scalpel amplified band was cut from the gel and kept in sterile 1.5 ml eppendroff.

Gel elution was done by using Gen eluteâ„¢ gel extraction kit (Sigma Aldrich).

Cut gel piece was dissolved in 3 volumes of "Gel dissolving solution" by heating the mixture at 55⁰C for 5-10 min.

DNA binding column was charged by adding 750 µl of "column preparation solution" and by keeping it for two min. Column was spun at 12,000 rpm for 2 min to remove column binding solution.

Mixture containing dissolved gel was loaded onto column and incubated for 2 min (to make sure DNA has bind to the column), then spun at 12,000 rpm for 2 min to remove remaining solution.

Column was washed with 750 µl of "wash solution" to remove any impurities and again spun at 12,000 rpm for 5 min.

An empty spin was given to remove all solution.

Column was transferred into new 1.5 ml microcentrifuge tube and 30 µl of "DNA binding solution" was added to the column and incubated for 5 min at 55⁰C, tubes were then spun again and extracted DNA was obtained in microcentrifuge tube.

An additional extraction step by adding 10-15 µl of "DNA binding solution" helped in recovery of 20% of DNA.

Eluted products were checked on 1.2% agarose gel for yield and quality.

4.4 Sequencing of amplified products:-

Sequencing of amplified products was done by TCGA (The Centre for Genomic Application) New Delhi.

4.5 Alignment of sequences:-

Sequences of amplified products were searched for homologous sequence by using NCBI's BLAST (Basic Length Alignment Search Tool).

Results

Sample details:

During this study total 4 nail samples were provided by RML Hospital.

Patient No.

Date of collection

Gender

Age

Sample weight

Remarks

1

16/01/10

M

32

28.5 mg

2

26/03/10

M

60

8.7 mg

Were on treatment for more than 1 month

3

13/04/10

M

37

45mg

Were on treatment for more than 1 month

4

13/04/10

F

63

Very less

Were on treatment for more than 2 months

Colonies details:

From above-mentioned clinical samples total 12 fungal colonies were isolated which were later tried to be identified by using sequence analysis. Colonies were identified as listed below.

Colony code

Identification by sequence analysis

FBT001 (1)

-

FBT001 (2)

Aspergillus flavus (ITS*)

FBT001 (3)

Ascomycota spp. (ITS*)

FBT001 (4)

Trichophyton rubrum (ITS*)

FBT002 (1)

Alternaria alternata (ITS*)

FBT002 (2)

-

FBT002 (3)

Aspergillus flavus (ITS*)

FBT002 (4)

Ascomycota spp. (ITS*)

FBT003 (1)

-

FBT003 (2)

Alternaria alternata (ITS*)

FBT003 (3)

-

FBT004 (1)

-

ITS*- identified on the basis of sequence analysis of ITS 1, 5.8s rDNA and ITS 2 sequence

By the sequence analysis of amplified regions 7 out of 12 fungi have been identified, 4 fungal colonies couldn't be identified because; desired amplification couldn't be achieved within the time duration of this study.

Detail results and discussion according colony wise have been given ahead.

Colony 1

Code: FBT001 (1)

Identification status: Unidentified

Phenol red test: negative (colour changed to yellow)

Colony morphology:-

Growth rates- SCC=poor, PDA= slow, SDA=Fair.

Colony was normally white, flat, and circular with pinkish purple colour on lower surface.

Amplification with LSU primers: amplification of large subunit rDNA was achieved only once when a gradient PCR between 53⁰C to 63⁰C was set with reaction mixture having 5% DMSO and 3 mM MgCl₂ and 0.5µM Primers (gel image 1). Amplified product couldn't be eluted because there were nonspecific amplifications.

Amplification with ITS primers: amplification with ITS primers couldn't be achieved.

Gel image 1: gradient PCR of Colony 1

Colony 2

Code: FBT001 (2)

Identification status: Aspergillus flavus

Phenol red test: negative (colour changed to yellow)

Colony morphology:-

Growth rates- SCC=fast, PDA= fast, SDA=fast.

Colony produced heavy green sporulation within 3 days of incubation. Shiny, dry powdery spores were produced all over the plate.

Amplification with LSU primers: amplification of large subunit rDNA couldn't be achieved as every time there were nonspecific amplifications of larger size.

Amplification with ITS primers: amplification with ITS primers produced a single band around 600 bp (gel image 2).

Gel image 2: ITS PCR of Colony 2

Colony 3

Code: FBT001 (3)

Identification status: Ascomycota spp.

Phenol red test: negative (colour changed to yellow)

Colony morphology:-

Growth rates- SCC=poor, PDA= slow, SDA=slow.

Colony was white or creamy white, circular, raised and a golden yellow pigmentation was produced on SCC medium and on SCC it was cottony.

Amplification with LSU primers: amplification of large subunit rDNA was achieved only once when a gradient PCR between 53⁰C to 63⁰C was set with reaction mixture having 5% DMSO and 3 mM MgCl₂ and 0.5µM Primers (gel image 1). Amplified product couldn't be eluted because there were nonspecific amplifications.

Amplification with ITS primers: amplification with ITS primers produced a single band around 600 bp (gel image 3).

Gel image 3: ITS PCR of Colony 3 & 5

Colony 4

Code: FBT001 (4)

Identification status: Trichophyton rubrum

Phenol red test: negative (colour changed to yellow)

Colony morphology:-

Growth rates- SCC=slow, PDA= good, SDA=good.

Colony was white or creamy white, circular, flat and a brown purple pigmentation was produced on SCC medium and radial grooves and patterns on both surfaces.

Amplification with LSU primers: amplification of large subunit rDNA couldn't be achieved during this study.

Amplification with ITS primers: amplification with ITS primers produced a single band around 600 bp (gel image 4).

Gel image 4: ITS PCR of Colony 4

Colony 5

Code: FBT002 (1)

Identification status: Alternaria alternate (ITS)

Phenol red test: negative (colour changed to yellow)

Colony morphology:-

Growth rates- SCC=slow, PDA= fair, SDA=good.

Colony was dirty white or grey, circular, flat, and lower surface was reddish brown or black.

Amplification with LSU primers: amplification of large subunit rDNA produced a single band around 300 bp when reaction was carried out with 5% DMSO, and 3mM MgCl₂ and 0.5µM primers. Sequence analysis was not possible because product yield was not sufficient for sequencing as informed by TCGA facility (gel image 5).

Gel image 5: LSU PCR of Colony 5

Amplification with ITS primers: amplification with ITS primers produced a single band around 600 bp (gel image 6). Sequencing was done of ITS amplified region.

Gel image 6: ITS PCR of Colony 5

Colony 6

Code: FBT002 (2)

Identification status: Unidentified

Phenol red test: positive (colour changed to pink)

Colony morphology:-

Growth rates- SCC=poor, PDA= poor, SDA=poor.

Colony was white, circular, convex and dark brown colour developed on lower surface with cracks at lower surface.

Amplification with LSU primers: amplification of large subunit rDNA couldn't be achieved during this study.

Amplification with ITS primers: amplification with ITS primers couldn't be achieved.

Colony 7

Code: FBT002 (3)

Identification status: Aspergillus flavus

Phenol red test: negative (colour changed to yellow)

Colony morphology:-

Growth rates- SCC=fast, PDA= fast, SDA=fast.

Colony produced heavy green sporulation within 3 days of incubation. Shiny, dry powdery spores were produced all over the plate.

Amplification with LSU primers: amplification of large subunit rDNA couldn't be achieved as every time there were nonspecific amplifications of larger size.

Amplification with ITS primers: amplification with ITS primers produced a single band around 600 bp (gel image 7).

Gel image 7: ITS PCR of Colony 7

Colony 8

Code: FBT002 (4)

Identification status: Ascomycota spp.

Phenol red test: positive (colour changed to pink)

Colony morphology:-

Growth rates- SCC=poor, PDA= poor, SDA=poor.

Colony was white or creamy white in colour, circular, flat, and yellowish orange coloured on the lower surface.

Amplification with LSU primers: amplification of large subunit rDNA couldn't be achieved in this study.

Amplification with ITS primers: amplification with ITS primers produced a single band around 600 bp (gel image 8).

Gel image 8: ITS PCR of Colony 8

Colony 9

Code: FBT004 (1)

Identification status: Unidentified.

Phenol red test: negative (colour changed to yellow)

Colony morphology:-

Growth rates- SCC=poor, PDA= poor, SDA=poor.

Colony was white or creamy white in colour, circular, flat, and yellowish orange coloured on the lower surface with grooves.

Amplification with LSU primers: amplification of large subunit rDNA couldn't be achieved in this study.

Amplification with ITS primers: amplification with ITS primers couldn't be achieved in this study.

Colony 10

Code: FBT003 (1)

Identification status: Unidentified

Phenol red test: positive (colour changed to pink)

Colony morphology:-

Growth rates- SCC=poor, PDA= poor, SDA=poor.

Colony was white or creamy white in colour, circular, flat.

Amplification with LSU primers: amplification of large subunit rDNA couldn't be achieved in this study.

Amplification with ITS primers: amplification with ITS primers couldn't be achieved in this study.

Colony 11

Code: FBT003 (2)

Identification status: Alternaria alternata.

Phenol red test: negative (colour changed to yellow)

Colony morphology:-

Growth rates- SCC=slow, PDA= fair, SDA=good.

Colony was dirty white or grey sometimes greenish, circular, flat, and lower surface was reddish brown or black.

Amplification with LSU primers: amplification of large subunit rDNA couldn't be achieved in this study.

Amplification with ITS primers: amplification with ITS primers produced a single band around 600 bp (gel image 9).

Gel image 9: ITS PCR of Colony 11

Colony 12

Code: FBT003 (3)

Identification status: Unidentified

Phenol red test: positive (colour changed to pink)

Colony morphology:-

Growth rates- SCC=poor, PDA= poor, SDA=poor.

Colony was white or grayish white in colour, circular, flat.

Amplification with LSU primers: amplification of large subunit rDNA couldn't be achieved in this study.

Amplification with ITS primers: amplification with ITS primers couldn't be achieved in this study.

Summary and Conclusions

In this study total 12 fungal colonies were isolated from nail samples suspected of having onychomycosis. Out of those 12 fungi, 7 were identified using molecular techniques. In this study only one dermatophyte could be identified e.i. Trichophyton rubrum, while others were Nondermatophytes.

Traditional culture based techniques for confirmatory identification were not applied but preliminary tests as ' growth on media with Cycloheximide and on media without Cycloheximide' didn't confirm presence of dermatophytes as almost all colonies were able to grow on both types of media with almost similar growth rate and macromorphology. 'Dermatophytic selective medium test' also did not produce conclusive results as colonies could only be distinguished as DTM positive or DTM negative.

Sequence analysis of both ITS region and 5.8s rDNA proved to be better technique for fungi identification as LSU region couldn't be amplified accurately for most of times. Amplification and sequence analysis of 28s rDNA couldn't be done because a single desired PCR product of ≈300 bp couldn't be obtained as always there was nonspecific amplification of larger fragments. Several techniques to reduce nonspecific amplification like 'hot start PCR', 'addition of salt and DMSO', 'reduction of template as well as primer' were tried out and conditions were tried to be optimized through gradient PCR but results were not obtained.

In order to get the results from PCR template gDNA was also purified using several methods to remove any impurities present with the gDNA (if there were any). Double precipitation with salt, additional washing steps were tried; but PCR could only be achieved after gel purifying the gDNA samples which removed the ionic impurities or inhibitors of PCR.

Molecular identification took just 3-5 days to identify fungi once conditions for PCR were optimized. Molecular identification can be a useful tool for accurate identification of fungal species. From medical prospective this method takes as much time as traditional methods but the confirmatory identification is much more accurate than of those by morphological identification. This method can be used for proper identification of etiological agent of onychomycosis which can be useful in correct treatment of disease; still repeated sample isolation and culture isolation is required to distinguish the etiological agent especially in the cases of Nondermatophytic and mixed infections.

PCR/ sequence based techniques are beneficial for fungal identification but still advancement of these molecular techniques is required for quicker and accurate identification. More studies generating sequence (whole genome as well as partial sequences) will only help in generating larger database and phylogeny of organisms which can be used in future.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.