Cloning And Characterisation Of Aedes Aegypti Heme Oxygenase Cdna Biology Essay

Published:

Ae. aegypti, much like many other blood-sucking insects, uses heme oxygenase enzyme to degrade free heme produced from blood digestion into non-toxic products. Today, heme oxygenase is agreed to have evolved as an evolutionary adaptation to protect Ae. aegypti against heme toxicity. Interest in Ae. aegypti as model organism in recent years has led to sequence of Ae. aegypti whole genome completed and published in 2007. Such database constitutes a powerful database tool necessary to carry on further molecular study on Ae. aegypti and particularly molecular characterisation of cDNA for Ae. aegypti mosquito.

Results.

Here, we report the use of Ae. aegypti genome database to clone successfully Ae. aegypti heme oxygenase cDNA sequences by polymerase chain reaction (PCR) using primers designed from a 933 base pair partial mRNA sequence searched through the NCBI GenBank database. The amplified products were purified , transformed and cloned by blunt-end ligation into pJET-1.2 cloning vector and finally digested with digestion enzyme BglII enzyme to produce heme oxygenase cDNA insert . Two positive cloned sequences were produced from the inserts sequencing and these cloned sequences were analyzed for homology. The results showed that the clones were both 99% homologous to conserved hypothetical protein and both show high degree of similarities with heme oxygenase protein of Culex quinquefasciatus ( 76% both clones) , Apis mellifera ( 67%,) Glossina morsitans morsitans(68%), Drosophila melanogaster( 34 % clone 1 ) heme oxygenase (Ho), mRNA .

Conclusion.

Lady using a tablet
Lady using a tablet

Professional

Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

Ae. aegypti heme oxygenase has been successfully cloned and the cloned sequence validated by homology search using basic local alignment tool search(BLAST). The result of this study facilitates the study for protein expression into an expression vector to express the primary sequence of Ae. aegypti heme oxygenase .

INTRODUCTION

Ae. aegypti , much like many other blood-sucking insects , uses heme oxygenase enzyme to degrade free heme produced from blood digestion into non-toxic products. Evolution of heme oxygenase in these insects is believed to evolve as an evolutionary trail that protects these insects against heme toxicity (Kikuchi et., al 2005; Poulos et al., 2005; Paiva-silva et al., 2006). According to the national centre for bioinformatics technology (NCBI) database prediction heme oxygenase gene encoded protein AaeL_AAEL008136 (NCBI. 2009; Sevenson et al., 2005) itself encoded by transcript AaeL_AAEL008136-RA both found on chromosome 1 of Ae. aegypti . The database NCBI and VectBase also reveal that Ae. aegypti heme oxygenase protein sequence is related to a 156 amino acid conserved hypothetical protein of Ae. aegypti (access number EAT40116.1) that today remained uncharacterised (NCBI,2009).

Graca-Souza et al (2006) study of heme oxygenase activity in blood feeders insects such Ae. aegypti illustrated the involvement of heme oxygenase in heme degradation in Ae. aegypti and bioassay evidence of heme oxygenase involvement in heme degradation pathway in Ae. aegypti have been provide by bioassay study which have shown that biliverdin , monoxide of carbon and iron are the end products of the pathway. The speculation about possible therapeutics properties of these end product against some diseases in human (Soares and Bach, 2009; Abraham and Kappas., 2008; Seixas et al., 2008; Morán et al,.2008; Lyoumi et al., 2007; Shibahara et al., 2002)

Heme oxygenase role in heme degradation has also attracted many researches in recent years in various heamatophagous insects (Graca-Souza et al, 2006; Paiva-Silva et al,.2 2006 ) including ticks Boophilus microplus (Lara et al.,2003; Lara et al., 2005 ), in Rhodnius prolixus (Oliviera et al,. 1995 ) and in Ae. aegypti (Pereira et al,.2007) . In these studies heme oxygenase mechanism of action have also been investigated as a regulatory key enzyme in heme degradation but also as an essential key player in heme recycling (Furuyama, et al; Ryter et al.; 2000) that these insects need for their amino acids nutrient requirement (Graca-Souza et al., 2006). Heme mechanism of action appeared to involve NAPDH cytochrome P450 reductase that have been shown to donate two electrons to heme oxygenase enzyme for activation (Higashimoto et al, 2006; Poulus et al,. 2005). Nonetheless, Kikuchi et al (2005) have shown that heme oxygenase could work independently from NADPH cytochrome P450 reductase.

Although a large amount of knowledge on heme oxygenase 's structure and function in heamatophagous insects has aroused from the study of its role and involvement in heme degradation (Pereira et al,.2007; Graca-Souza et al., 2006; Paiva-silva et al., 2006) , many of biomolecular understanding on heme oxygenase in Ae. aegypti has aroused from recent development of detailed genetic and physical maps for Ae. aegypti (Waterhouse et al,.2008;Sevenson et al ., 2004 ), phylogeny and classification study(Reinert et al,.2004) and finally from Ae. aegypti whole genome organization sequencing project (Nene et al., 2007) which has been completed and published through GenBank database under version number AAGE00000000 ( NCBI, 2009).

Lady using a tablet
Lady using a tablet

Comprehensive

Writing Services

Lady Using Tablet

Plagiarism-free
Always on Time

Marked to Standard

Order Now

Figure 1 .Overview pathway of heme degradation pathway in heamatophagous insects such as Ae. aegypti to generate biliverdin as end product (Pereira et al, .2007)

In this study, we report the use bioinformatics database search, sequence alignment approach combined with DNA recombinant techniques to clone Ae. aegypti heme oxygenase cDNA using PCR amplification with primers derived from heme oxygenase hypothetical partial mRNA sequence searched in national NCBI database (NCBI,2009). Cloning was achieved using a combination of molecular techniques including PCR amplification, DNA purification, blunt end ligation into a cloning vector, transformation, selection and screening for recombinants and restriction digestion with digesting enzyme. The work also involved bioinformatics analysis using Basic local alignment tool (BLAST) search which to produce a unique sequence of Ae. aegypti heme oxygenase cDNA publishable in the NCBI database.

EXPERIMENT METHODS

I . Primer Design

Primers were designed following standard rules: approximately 18-22 bases of complement sequence; must have a 50% G-C content; must have a G or a C at the 3' end of the primer sequence. The primer sequences were designed from Ae. aegypti hypothetical heme oxygenase mRNA sequence (Protein ID #: XM_0016589559 fig 2) found at the National Center for Biotechnology Information (NCBI). The start primer used, was as follows: Ae. aegypti : 5'-GAGACCATGGCTTTCACA-3' and (236) the reverse primer was : 5'-TCTCAAGCTTTTATTTTAA-3'. The primers were then verified for their specificity of hybridizing to the DNA by carrying out BLAST searches against the Ae. aegypti heme oxygenase hypothetical mRNA sequence before the desired sequences were sent out for production. The search showed significant homology up to 99% to AY 433250 Ae. aegypti putative mRNA sequence 99 % to EAT40116.1

ttgttatcgcagccaaatcaatccagacatcggcccagacggagagaataacggtttctg

L L S Q P N Q S R H R P R R R E - R F L

ttgtacgcactattgttttcatcattcagcgcacgggaaacg atgtctttcacaaagga

L Y A L L F S S F S A R E T M S F T K E

atgcgcgtagctacacgggacattcacaacgttagcgatgcattggttaatgcaaaactt

M R V A T R D I H N V S D A L V N A K L

gctttcgccctttatgacagtggagtgtgggcggaaggtctgctaatattctacgacatc

A F A L Y D S G V W A E G L L I F Y D I

ttcaaatatctcgaggaaaatgtatcgcatgacttcctgccggaggaatatcaccgaacg

F K Y L E E N V S H D F L P E E Y H R T

caacagtttgaagaagatttaactttctacttgggtgccgattggaagtccaagcaccag

Q Q F E E D L T F Y L G A D W K S K H Q

ccccgcaaagaagtctgcgattacatcaaacatctcgagcagctgcaaggggaaaatccc

P R K E V C D Y I K H L E Q L Q G E N P

aatctactggtggcttatgtctatcatctgtacatgggactactttctgggggtcagatt

N L L V A Y V Y H L Y M G L L S G G Q I

ttacagaaacgaagaaactttactaagaagttcaatccctttgccaatggaaacggtgct

L Q K R R N F T K K F N P F A N G N G A

agaggcgcagcgttgacgacgtttgaggagcacagtatctacgaattgaagcaaaaaatg

R G A A L T T F E E H S I Y E L K Q K M

aggaaaaccatcgatgagtttggcgacggtttggacgaggacacacgaaagcgaatgatg

R K T I D E F G D G L D E D T R K R M M

gacgaaagccggaaggtgttcgaaatgaacaatgaaataatcaaaacggtcaagggagtt

D E S R K V F E M N N E I I K T V K G V

aaccgtgcaaatattaaaacaatagtttatgttatagttttgataattctatactttgtt

N R A N I K T I V Y V I V L I I L Y F V

ttgaaacaatttattttaaaataa tattagaatacaattgaaacaggaaactgttcaaa

L K Q F I L K - Y - N T I E T G N C S K

tgtgataaatattggatactagtagttcaatatctttagtagatggaagcgaaaattaac

C D K Y W I L V V Q Y L - - M E A K I N

tccatattataattgtatttttctggttttag

S I L - L Y F S G F S

Figure 2. XM_001658905 described as Ae. aegypti partial hypothetical mRNA nucleotide sequence of Ae. aegypti and its deduced translation sequence. Nucleotides numbered in the 5' to 3' direction are shown on the right side of the sequence. Nucleotide residue 1 is the A of the initiating methionine (codon ATG) and the nucleotides on the 5' side of residue 1 are indicated by negative numbers (-). The deduced amino acids are shown below the nucleotide sequence and are numbered beginning with the initiating methionine. The putative membrane segment and the polyadenylylation signal, AATAAA (39), are underlined. The poly (dA) tract (-150 residues) is not included

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

1 cattcggcgc acgggaaacg atgtctttca caaaggaaat gcgcgtagct acgcgggaca

61 ttcacaacgt tagcgatgca ttggttaatg caaaacttgc tttcgccctt tatgacagtg

121 gagtgtgggc ggaaggtctg ctaatattct acgacatctt caaatatctc gaggaaaatg

181 tatcgcatga cttcctgccg gaggaatatc accgaacgca acagtttgaa gaagatttaa

241 ctttctactt gggtgccgat tggaagtcca agcaccagcc ccgcaaagaa gtctgcgatt

301 acatcaaaca tctcgagcag ctgcaagggg aaaatcccaa tctactggtg gcttatgtct

361 atcatctgta catgggacta ctttctgggg gtcagatttt acagaaacga agaaacttta

421 ctaagaagtt caatcccttt gccaatggaa acggtgctag aggcgcagcg ttgacgacgt

481 ttgaggagca cagtatctac gaattgaagc aaaaaatgag gaaaaccatc gatgagtttg

541 gcga

Figure 3. Putativeheme oxygenase mRNA sequence published in NCBI database access number AY433250 and described as partial mRNA protein probably identified through Ae. aegypti whole genome sequencing (NCBI, 2009)

II. Cloning of Ae. aegypti heme oxygenase cDNA Gene by PRC amplification.

1. PCR and Gel Electrophoresis

a. Initial PCR reactions was set up using forward and reverse primers designed based on Ae. aegypti heme oxygenase mRNA sequence .Forward primer as primer-I: 5- GAGACCATGGCTTTCACA 3'; and reverse primer was primer-II: 5'- TCTCAAGCTTTTATTTTAA 3' designed based on a hypothetical partial mRNA gene sequence of Ae. aegypti heme oxygenase . PCR primers from manufacture were reconstituted in distilled water to a 100 picamolar per uL concentration using kappa HI-FI polymerase. For PCR, a 5 picamolar per uL (1:20 dilution) of primers was used. The PCR reactions were conducted according to procedures in the lab manual. The PCR mix PCR was performed in a mixture of 50 μL total volumes PCR reaction containing 1μ/L of larval cDNA from anopheles Gambia as DNA template , 1.5 μL of the heat-resistant DNA polymerase kappa hi-fi (polymerase Taq) , 1μL/ 200uM of dNTPs , 5 μ /L of 10 times buffer, and 4μ/L of each of the two primers diluted. Primer extension times set to 95â-¦C for 2 minute to melt the DNA into single strands followed by 25 cycles of 42â-¦C for -50â-¦C for 20 seconds cooling temperature for 20 second where the primers anneal (hybridize) to the complementary strands, then, the incubation continued at 68â-¦C for 1 minute to allow Taq polymerase to extend the primers followed by an additional 10 minutes at 68 â-¦C resulting in the synthesis two partial double stranded DNA molecule of cDNA . PCR-amplified products were separated by gel electrophoresis (0.9%) and then visualized with ethidium bromide to confirm PCR amplification.

b. Failure in the initial PCR led to a second PCR reaction was carried out after checking of pipettes for accuracy and a review of reagent concentration (Table 2) as PCR troubleshooting strategy .However, the arogase gel electrophoresis analysis of the second PCR product did not show any amplification as expected thus the result was not successful. To optimise the PCR two more steps targeting primers redesign and PCR cycles parameters were taken Primers test PCR reaction was carried out using primers ECG 231 and ECG 232 from anopheles Gambiae which has been known to work in previous PCR amplification under different PCR reaction cycle parameters.

c. Third PCR reaction was set up (Table 3) for two samples plus two controls. The total PCR volume of 25uL made of 0.75uL 0f dNTP, 5uL of 10x buffer, 2uL of ECG231 and ECG 232 primers, 0.5uL of polymerase Taq, 1uL of Kisumu larval cDNA in one tube and plasmid DNA in another tube as template, and 13.75 uL of water .Two control one with 1uL of genomic DNA with positive control primer ECG 197 AND ECG 198 and the second with plasmid DNA A. 192 with the same primers ECG 197 and ECG 198 diluted 1:100 fold. PCR condition was also changed to 95c for 2minutes followed by 25 cycles of 98c for 20 seconds followed by 50cC cooling temperature for 30 seconds and 68C for 2 minutes and the whole reaction was held at 68C for 10minutes. Gel arogase separation, gel electrophoresis of the PCR products confirm our expectation and confirmed that micropipette calibration control has paid off. The experiment will therefore go ahead to use Ae. aegypti heme oxygenase primers ECG 235 and ECG 236. PCR reaction was carried out using Ae. aegypti primers ECG 235 and ECG 236 with larval cDNA as template and primers ECG 231 and ECG 232 with plasmid DNA A 192 as control was carried out and gel electrophoresis separation and visualized on visualized with ethidium bromide showed no amplification of Ae. aegypti heme oxygenase but the plasmid DNA amplification was positively amplified. The initial PCR reactions these primers 235 and 236 were unsuccessful probably .Therefore, experiments were carried out to optimise PCR conditions. It was found that new primers ECG 23 were not amplifying probably because these were designed as external primers so new primers probably internal in opposition to the primers 235 and 236 were made.

2. Primers redesign and fourth PCR reaction

As PCR troubleshooting strategy new internal primers different to the first one, which were external primers and the diagram (Fig 4), illustrates the approach taken to redesign primers.

The fourth PCR reaction to test all these primers was set up and all the reagent concentration were kept the same as previously and PCR condition were kept unchanged (Table 1 column 4and 5) and the amplified PCR product were visualised by gel electrophoresis to reveal that only internal primers ECG 239 and ECG 241 were amplified. Then, another PCR reaction using ECG 239 and ECG 241 primers and cDNA from anophele gambiae larval as template and plasmid DNA A192 as control was carried out to confirm the results. Arogase gel electrophoresis analysis confirmed positive Ae. aegypti heme oxygenase cDNA gene amplification. The results showed two amplified bands of about 800 -900 base pair as expected thus a conclusion that PCR amplification of Ae.aegypti heme oxygenase cDNA was successful (Fig 9)

239

237

240

238

241

UTR

TAA

UTR

ATG

236

235

Figure 4.Primers redesign approach 235 and 236 so far used primers, newly designed: 239 and 241 redesign of the primers 239 forward and 241 reverse sequence 5'- ttgtacgcactattgttttcatc - 3' and 5'- gaacagtttcctgtttcaattgtattc - 3' then . (237): 5' - gagaccatggctttcacaaaggaaatg - 3, and (238): 5'- Gaaacaatttattttaaaataat 237 and finally primers (240): 5' - ccccgcaaagaagtctgcgattac - 3 (238): 5'- Gaaacaatttattttaaaataat - 3'. From all the primers was internal primer just after the UTR region and before the ATG starting codon and primer 237 and 240 forward after start codon and 238 reverse primers after the stop codon TAA.

Table 1. Summarises the third and fourth PCR reaction and the concentration of reagent used in both PCR reactions

Reagent in start stock (uL)

Sing single reaction

( uL)

*Master mix reaction of 4.5 samples (uL)

**PCR

4

single reaction

Master mix for 2 samples(uL)

H2o

13.75

61.75

31.5

315

10uMdNTP

0.75

3.375

1.5

21

10X Buffer

5

22.5

5

70

5uMPrimer 1

2

9

4

56

5uMPrimer 2

2

9

4

56

10u/Ltaq

0.5

2.25

1.5

1.5

Template*

1

1

2.5

35

Total

25

500

50

150

* Master Mix for 4.5 sample used in PCR 3 with. Column 2 and 3 refer to PCR 3 and column 4 and 5 refers to PCR 4. PCR 4 refers to the fourth PCR which used only samples were used with sample one made of ECG 235 and ECG 236(designed primer of Ae. aegypti heme oxygenase.) and larval cDNA as template and sample 2 was the positive control made of primers 231 and 232 with plasmid DNA A192.

3.BLAST search for the gene insert sequences

BLAST searches were conducted using the National Centre for Biotechnology Information's (NCBI) database with the DNA sequences results. BLAST searches were performed to see what proteins showed homology to the gene insert sequences. To conduct a BLAST search of the entire database one must go to the National Center for Biotechnology Information's website (NCBI 2009). On the top of the webpage the "BLAST" option was selected. On the subsequent pages, "blastx" was selected. A "blastx" search compares a nucleotide sequence to a protein sequence (NCBI 2007). The gene insert sequence will then be copied and pasted into the query box and format was selected to perform the database search. Before the sequences could be copied into the query, they had to be altered to remove the " NNN" codons which did not produce a viable sequence ( figure 12 and 13)

III.Heme oxygenase cDNA gene subcloning into cloning vector pJET-1.2

1. PCR purification and ligation into pJET1.2 cloning vector and E. coli transformation

QIAquick PCR purification kit was used to purify amplified PC R product by adding 90 µL of DNA PCR product was suspended in 5% volume of PB buffer and the mixture DNA was bound to a silica membrane at pH of 7.5 with , then washed out with 0.75 µL of buffer ethanol-containing Buffer PE and centrifuged for one minute and finally eluted with 50µL of Elution Buffer EB made of 10 mM Tris·CI at pH 8.5 and centrifuged for one minute to collect purified plasmid DNA. The resulting plasmid was then ligated into pJET-1.2 cloning vector following the procedure outlined in Fermatas' manual "CloneJETâ„¢ PCR Cloning Kit" - (Fermentas,.2010). The ligation reaction included 10 µL of buffer, 1µL of purified plasmid, 1µL of vector, 1µL of Tu DNA ligase and 6µL of water in a total ligation reaction volume of 20µL. The whole mixture was briefly vortex, centrifuged for 3mimutes and then incubated at 22â-¦C for 5 minutes. The PCR/vector was transformed into competent E-coli DH5α cell. E. coli cells from and spread onto an agar plate containing the antibiotic ampicilin (0.5 mg/mL) accordingly to Fermentas protocol (Fermentas, .2010). The plate was incubated at 37.0°C for 1 hour at 225pm. A positive control pUC-19 control DNA was also carried out.

2. PCR screening for transformed colony were was carried out by PCR reaction (Table 1 column 4 and 5) and the reaction was visualized in gels containing 0.9% agarose in 40 mM Tris-base pH 8.3, 20 mM acetic acid, 1 mM EDTA and 0.001% ethidium bromide to check for the insert

Figure 5. represents cloning vector pJET1.2 the vector with its a rep (pMB1) replication start , multiple cloning site showing two BglII cutting sites, bla(ApR) ampicilin resistant site and eco47IR lethal site ( Qiagen, 2010)

3. Plasmid Preparation and Restriction Enzyme Digestion. Before the fourth lab period, four putatively transformed colonies were picked using sterile toothpicks and grew them overnight with shaking at 37°C in liquid Luria-Bertani (LB) growth media containing 5µL ampicillin. To extract the plasmids from the DH5 E. coli, procedures outlined in Qiagen's Miniprep Handbook were followed on pages 18-20: "QIAprep Spin Miniprep Kit Protocol (Qiagen,.2010). Once the pJET1, 2 vectors were re-isolated, they were subjected to a restriction digest with BglII for 2h45 minutes. The digestion reaction was made of 5µL of plasmid DNA, 1µL of Bgl II, 1µL of 10X digestion buffer and 3µL of water.The reaction mixture were kept at 37C for 2hours and forty five minutes. Gel electrophoresis (1% agarose) was run at 100 volts (V) for fragment length confirmation. Bands were expected in all lanes at 900 bp and 900 bp in length

4. DNA preparation for sequencing. 20 µL of 100ng/µL of mini-prepped plasmid was and 10 µL at 1pmol/µL of primers 239 and 241 mixed separately to ensure full length coverage of the insert on both strands and sent for DNA sequencing.

RESULTS

I. Cloning of Ae. aegypti heme oxygenase cDNA

1. Amplification of the heme oxygenase cDNA

Heme oxygenase cDNA was amplified by PCR using primers designed from predicted Ae. aegypti heme oxygenase mRNA sequence. The primers used to obtain the PCR product were designed to amplify Ae. aegypti heme oxygenase cDNA sequence between the primers, but amplification did not occur until the fourth PCR reaction. Two initial PCR produced smear band or practically not visible as described in figure 6

Lanes 1 2 3 4 DNA marker 7 8 9 10 11 12 13 14

Figure 6. Gel electrophoresis results after initial PCR reactions for Ae. aegypti heme oxygenase . A 5µL per 1kb ladder was used for size estimation. Initial PCR of the two positive controls: genomic DNA from Anopheles gambiae (smear band line 1, 2and 3) and plasmid DNA of the cloned heme oxygenase cDNA (lanes on the left) did not amplified at all. Note however, the marker band which is quite distinctively clear to rule out PCR equipment technical failure

The third PCR described in Figure 7 did not produced amplification of PCR products however, amplification of gDNA and plasmid DNA using control primers (known to work in previous reaction) used as control suggested that the primers might not worked as expected. Hence, new primer were designed (Figure 4) to optimise PCR conditions

Sample 1 2 3 4 5 6 7

900

1Kb

Figure 7. Gel electrophoresis results of the third PCR reaction for Ae. aegypti heme oxygenase cDNA amplification . A 5µL per 1kb DNA marker was used for size estimation. In this PCR, lane 1, 2, and 8 contained PCR product with primers ECG 232 and 233.Lane 4 contains plasmid DNA A.192 with the primer 197 and 198 and Line 5 contained genomic DNA with positive control primer used in line 4. Both. Line 4 and 5 showed bands. The arrow indicates the position of the expected size for PCR products.

PCR amplification of Ae. aegypti heme oxygenase was successful in the fourth PCR .Figure 9 shows the PCR products from Ae. aegypti heme predicted oxygenase mRNA sequence. The two bands in lane 1 and 2 appeared between the marker bands at about 800 and 900 bp, and were estimated to be about 933 bp in length as reported by NCBI (NCBI, 2009)

Lane 1 2 DNA marker

900

700

Figure 8. Gel electrophoresis photograph of Ae. aegypti heme oxygenase cDNA. PCR product in a 1% arogase gel. Lane 1 and lane 2 contain PCR product from Ae. aegypti heme oxygenase cDNA and lane 3 contain DNA marker se140 G2 .The arrow to the right point to the location corresponding to Ae. aegypti heme oxygenase size expected to be about 800-900 bp as expected.

2.PCR Purification, Blunt-End Digestion, Ligation, and transformation.

Because the third PCR produced an amplified product after PCR optimazation the project was able to proceed with the PCR purification step. Once purified, the PCR products were ligated to vector, and used to transform chemically competent E. coli. Success was monitored by obtaining colonies capable of surviving on selection plates. Both 100 µL and 400 µL produced considerable numbers of colonies, typically, each plate contained more than 100 colonies growing on them. .The project also succeeded at ligation and transformation this was expected due to higher efficiency

3.Plasmid Preparation and Restriction Enzyme Digestion.

Then four plasmid were prepared by picking up four colonies from their plate by using a sterile toothpick and grew them overnight in LB growth media broth containing ampicillin and next morning plasmid minipreps were performed to purify and isolated plasmid which were then digested with restriction enzyme and insert were confirm inserts via gel electrophoresis

Lanes 1 2 3 4 DNA markers

500

800

900kb

Figure 9. Gel electrophoresis results of BglII restriction enzyme digestion of Ae. aegypti heme oxygenase cDNA ligated into cloning vector pJET 1, 2 cloning. Lane 1, 2, 3, 4 contain digestion product and lane 5 contain DNA marker. A 5µL / 1kb volume was used for size estimation. The arrow indicates the digested inserts. From four samples only two appeared to have been successfully digested by digest enzyme BglII. The cloning vector used was approximately pJET1.2 cloning vector was 3000 base pairs and both inserts appeared to be roughly about 800-900 base pair as expected.

4. Clones sequencing results and BLAST search analysis

The gene insert sequence was copied and pasted into the query box and format was selected to perform the database search( see methods ). Before the sequences could be copied into the query, they had to be altered to remove the " NNN" codons which did not produce a viable.

a. Clones sequences

From the three cloned sent for sequencing, two samples (clone 1 and 3) showed two positive sequences: clone 1 (figure 11) and clone 3 (figure 12). Clone 1 is a 1246 bp linear DNA sequence with 278 ambiguous , 278 low quality 294 medium quality and 674 high quality whereas clone 3 (figure 12) showed a 1235 base pairs linear with 299 ambiguous , 299 low quality plus 254 medium quality and 682 high quality.

Table 2. clone 1 sequence

1 NNNNNNNNNN NNANNNNNTT CNAANNAAGT ATAGAATTAT CAAAACTATA ACATAAACTA

61 TTGTTTTAAT ATTTGCACGG TTAACTCCCT TGACCGTTTT GATTATTTCA TTGTTCATTT

121 CGAACACCTT CCGGCTTTCG TCCATCATTC GCTTTCGTGT GTCCTCGTCC AAACCGTCGC

181 CAAACTCATC GATGGTTTTC CTCATTTTTT GCTTCAATTC GTAGATACTG TGCTCCTCAA

241 ACGTCGTCAA CGCTGCGCCT CTAGCACCGT TTCCATTGGC AAAGGGATTG AACTTCTTAG

301 TAAAGTTTCT TCGTTTCTGT AAAATCTGAC CCCCAGAAAG TAGTCCCATG TACAGATGAT

361 AGACATAAGC CACCAGTAGA TTGGGATTTT CCCCTTGCAG CTGCTCGAGA TGTTTGATGT

421 AATCGCAGAC TTCTTTGCGG GGCTGGTGCT TGGACTTCCA ATCGGCACCC AAGTAGAAAG

481 TTAAATCTTC TTCAAACTGT TGCGTTCGGT GATATTCCTC CGGCAGGAAG TCATGCGATA

541 CATTTTCCTC GAGATATTTG AAGATGTCGT AGAATATTAG CAGACCTTCC GCCCACACTC

601 CACTGTCATA AAGGGCGAAA GCAAGTTTTG NATTAACCAA TGCATCGCTA ACGTTGTGAA

661 TGTCCCGTGT AGCTACGCGC ATTTCCTTTG TGAAAGACAT CGTTTCCCGT GCGCCGAATG

721 ATGAAAACAA TAGTGCGTAC AAATCTTGCT GAAAAACTCG AGCCATCCGG AAGATCTGGN

781 GGCCGCTCTC CCTATAGTGA GTCGTATTAC GCCNGATGGA TATGGNGNTC NGNNNCAAGT

841 GTTAAAGCAG TTGANTTTAT TCACTATGAT GAAAAAAACN ATGNATGGNA NCTGNTNCNA

901 GTTAAAANTA GANATANTAN CGAAAANNNN TCGAGTAGTA ANANNANAGA NNNACANNNT

961 AAAAAANNGG NNTTAGAACT TANNCNNNNN GNGNTGCTNC NNNNNGGGAC NNNTTNNNNA

1021 NGNANNNNCA TCNNNNNTNN NNNNNANNNN TNNNNCTTTN NNNNANNNNT NNNNANNNNN

1081 NNNNNNGNNG NNGGGNNNNN NNNNNNNNNN NNNNTTTTNN NNNNNNNNNN NNNNNNNNAN

1141 NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNANNNN

1201 NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN CCNNNN

Clone 1 sequence appears to be a 1246 base pair linear DNA sequence as results of clone 1 sample sequencing results note however N letter which shows codon which had fail to sequence.

Table 3. clone 3 sequence

1 NNNNNNNNNN NTNNNNNNNN NNNNGNNNGC GCGTAGCTAC NCGGGACATT CNCAACGTTA

61 GCGATGCATT GGTTAATGCA AAACTTGCTT TCGCCCTTTA TGACAGTGGA GTGTGGGCGG

121 AAGGTCTGCT AATATTCTAC GACATCTTCA AATATCTCGA GGAAAATGTA TCGCATGACT

181 TCCTGCCGGA GGAATATCAC CGAACGCAAC AGTTTGAAGA AGATTTAACT TTCTACTTGG

241 GTGCCGATTG GAAGTCCAAG CACCAGCCCC GCAAAGAAGT CTGCGATTAC ATCAAACATC

301 TCGAGCAGCT GCAAGGGGAA AATCCCAATC TACTGGTGGC TTATGTCTAT CATCTGTACA

361 TGGGACTACT TTCTGGGGGT CAGATTTTAC AGAAACGAAG AAACTTTACT AAGAAGTTCA

421 ATCCCTTTGC CAATGGAAAC GGTGCTAGAG GCGCAGCGTT GACGACGTTT GAGGAGCACA

481 GTATCTACGA ATTGAAGCAA AAAATGAGGA AAACCATCGA TGAGTTTGGC GACGGTTTGG

541 ACGAGGACAC ACGAAAGCGA ATGATGGACG AAAGCCGGAA NGTGTTCGAATGAACAATG

601 AAATAATCAA AACGGTCAAG GGAGTTAACC GTGCAAATAT TAAAACAATA GTTTATGTTA

661 TAGTTTTGAT AATTCTATAC TTTGTTTTGA AACNATTTAN TTTAAAATAA TATTANAATA

721 CAATTGAAAC ANGAAACTGT TCATCTTTCT AGAANATCTC CTACNATANT CTCAGCTGCC

781 ATGGAAAATC GATGTTCTTC TTTTANTCTC TCNAGANTTN CNNGCTGNAT ATTAAANCTT

841 ATATTAAGAA CTATGCTAAC CNCCTCATNN NNAANCGNTG TNGNNGGNNG NNGGGNTTTC

901 NNGNCANNCG ACTCNCATGA AANNACNANC NNAANATTCN ANANGNTCCNNTGANNNNT

961 TTANTCNNCN TTTTTTTNAA NNNNNNTTNN AGCNNGNNNN NGNANCTGNN NNNNNNNNNT

1021 TNNTTAANNN NNNANTTTNA NNANNTNNNN NNNNNNCATN NNTTTTTTG NNNCANNNNN

1081 NNNNCNNNNN NANNNNNNNN NNNNNNNTTN NNNNNNNNNN NNNNNNNNNNNNNNNNNN

1141 NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNGGNNNNGNNNNN

1201 NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNN

Clone 3 sequencing result shows a base 1235 base pairs linear DNA sequence as results of clone sample 3 sequencing note however N letter which shows codon which had fail to sequence.

b. Clones sequence homology search using BLAST tool

Table 4. clone 1 sequence without the NN repeats

1 NAGGANNGCG CGTAGCTACN CGGGACATTC ACAACGTTAG

61 CGATGCATTG GTTAATGCAA AACTTGCTTT CGCCCTTTAT GACAGTGGAG TGTGGGCGGA

121 AGGTCTGCTA ATATTCTACG ACATCTTCAA ATATCTCGAG GAAAATGTAT CGCATGACTT

181 CCTGCCGGAG GAATATCACC GAACGCAACA GTTTGAAGAA GATTTAACTT TCTACTTGGG

241 TGCCGATTGG AAGTCCAAGC ACCAGCCNCN NAAAGAAGTC TGCGATTACA TCAAACATCT

301 CGAGCAGCTG CAAGGGGAAA ATCCCAATCT ACTGGTGGCT TATGTCTATC ATCTGTACAT

361 GGGACTACTT TCTGGGGGTC AGATTTTACA GAAACGAAGA AACTTTACTA AGAAGTTCAA

421 TCCCTTTGCC AATGGAAACG GTGCTAGAGG CGCAGCGTTG ACGACGTTTG AGGAGCACAG

481 TATCTACGAA TTGAAGCAAA AAATGAGGAA AACCATCGAT GAGTTTGGCG ACGGTTTGGA

541 CGAGGACACA CGAAAGCGAA TGATGGACGA AAGCCGGAANGTGTTCGAAATGAACAATGA

601 AATAATCAAA ACGGTCAAGG GAGTTAACCG TGCAAATATT AAAACAATAG TTTATGTTAT

661 AGTTTTGATA ATTCTATACT TTGTTTTGAA ACAATTTATT TTAAAATAAT ATTAGAATAC

721 AATTGAAACA GGAAACTGTT CATCTTTCTA GAANATCTCC TACAATATTC TCAGCTGCCA

781 TGGAAAATCG ATGTTCTTCT TTTATTCTCT CAAGANTTTC NNNTGTATAT TAAAACTTAT

841 ATTANNAACT ATGCTAACCA CCTCATC

The sequence is the part of clone 1 sequence without the NN repeats. The sequence showed that form 1246 bp in figure 11 the sequence was reduced to 841 base pair. Positive sequence refers to successful sequence in opposition to fail codon which produced NN letter as part of the sequence that did not successfully sequence.

Table 5. clone 3 sequence without the NN repeats

1 ANNNAGTATA GAATTATCAA AACTATAACA TAAACTATTG

61 TTTTAATATT TGCACGGTTA ACTCCCTTGA CCGTTTTGAT TATTTCATTG TTCATTTCGA

121 ACACCTTCCG GCTTTCGTCC ATCATTCGCT TTCGTGTGTC CTCGTCCAAA CCGTCGCCAA

181 ACTCATCGAT GGTTTTCCTC ATTTTTTGCT TCAATTCGTA GATACTGTGC TCCTCAAACG

241 TCGTCAACGC TGCGCCTCTA GCACCGTTTC CATTGGCAAA GGGATTGAAC TTCTTAGTAA

301 AGTTTCTTCG TTTCTGTAAA ATCTGACCCC CAGAAAGTAG TCCCATGTAC AGATGATAGA

361 CATAAGCCAC CAGTAGATTG GGATTTTCCC CTTGCAGCTG CTCGAGATGT TTGATGTAAT

421 CGCAGACTTC TTTGCGGGGC TGGTGCTTGG ACTTCCAATC GGCACCCAAG TAGAAAGTTA

481 AATCTTCTTC AAACTGTTGC GTTCGGTGAT ATTCCTCCGG CAGGAAGTCA TGCGATACAT

541 TTTCCTCGAG ATATTTGAAG ATGTCGTANA ATATTAGCAG ACCTTCCGCC CACACTCCAC

601 TGTCATAAAG GGCGAAAGCA AGTTTTGNAT TAACCAATGC ATCGCTAACG TTGTGAATGT

661 CCCGTGTAGC TACGCGCATT TCCTTTGTGA AAGACATCGT TTCCCGTGCG CCGAATGATG

721 AAAACAATAG TGCGTACAAA TCTTGCTGAA AAACTCGAGN CATCCGGAAG ATCTGGCGGN

781 CGCTCTCCCT ATAGTGAGTC GNANTACGCC GGATGGATAT GGNGNTCNNN NACAAGTGTT

841 AAAGCAGTTG ATTTTATTCN CTATGATGAA AAAAACNATG NATGGNNNCT GNTCCNAGTT

901 AAAAANNGAG NNNNACCGAA NNTCNNCNAG NAGNANANTN GANANANACA C The sequence is the part of clone 3 sequence without the NN repeats. The sequence showed that from 1235 bp in figure 11 the sequence was reduced to 901 base pair.

Clone 1 similarity search results shows that clone 1 sequence is 99% homologous to a 233 amino acid putative uncharacterized conserve protein of heme oxygenase EMBL EAT40116.1 .clone 1 also has 76% similarity to heme oxygenase 1 of Culex quinquefasciatus (B0WJ98_CuLQU) . Less significant is the clone homology to heme oxygenase of Apis mellifera (45%), Glossina morsitan morsitan ID (38%) and heme oxygenase of Drosophila melanogaster (34%)

Table 6. Clone 1 nucleotide homology found using nucleotide query by BLAST search.

Access ID number

Source

Identity%

Q16ZP2 AEDE

B0WJ98 CµLQU

Putative uncharacterized protein Ae. aegypti

99 

Heme oxygenase 1 Culex quinquefasciatus

76 

Q5TLD7_APIME 

Heme oxygenase Apis mellifera

45 

D3TPD2_GLOMM 

Q9VGJ9_DROME 

Heme oxygenase Glossina morsitans morsitans

38 

Heme oxygenase Drosophila melanogaster

34 

The table shows Clone 1 homology % with organism ID and alignment and source putative uncharacterised heme oxygenase conserve protein being the highest match with 99% followed byheme oxygenase of Culex quinquefasciatus with 76% , then heme oxygenase of Apis mellifera on 45 and Drosophila melanogaster with 34%.

Clone 3 sequence results shows that clone 3 has 99 % similarity with gb|EAT40116.1| conserved hypothetical protein [Ae. aegypti ] , 76 % similarity with XP_001848782.1heme oxygenase 1 [Culex quinquefasciatus ] followed by 68% homologous to heme oxygenase sequence of Apis mellifera , Glossina morsitan morsitan and drosophila persimilis and drosophila grimshawi and finally 67 % similarity with Apis mellifera Culex (table 7)

Table 7. Summary of Ae. aegypti heme oxygenase clone 3 sequence homology searched using blastx matrix BLOSUM62 mRNA

Description

identity similarity %

gb|EAT40116.1| conserved hypothetical protein [Ae. aegypti ]

99%

XP_001848782.1heme oxygenase 1 [Culex quinquefasciatus ]

76%

NP_001011641.1heme oxygenase [Apis mellifera]

67%

ADD19560.1heme oxygenase [Glossina morsitans morsitans]

68%

XP_002019395.1 GL12384 [Drosophila persimilis] >

68%

XP_001990391.1 GH18266 [Drosophila grimshawi]

68%

DISCUSSION

The work reported here successfully cloned two clone samples (clone 1 and clone 3) of Ae. aegypti heme oxygenase . Both clone sequences showed significant identity homology to aedes aegypti conserved protein domain as well high homology to heme oxygenase of few organism including Culex quinquefasciatus , Apis mellifera , Glossina morsitans morsitans, and Drosophila melanogaster,. The results found are significant not only because the learning goal of this project have been achieved but also because the findings will facilitate futures studies on Ae. aegypti heme oxygenase gene including Ae. aegypti heme oxygenase protein expression by putting clone heme oxygenase cDNA gene into an expression vector to determine the primary structure of Ae. aegypti heme oxygenase cDNA. The benefits of such study would allow to determine variability of specific genes and gene products that can be used to explore gene function, gene expression, genome organization, and answer evolutionary question .

AKNOWLEDGMENT

I would like to thank Miss Patricia Pagnatelli for her expertise and support during the course of this project and all the lab- technicians, who provided invaluable assistance. My special thanks to my project supervisor Dr. Mark PAINE for technical support and guidance.