Children With Acute Lymphoblastic Leukemia Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

ABSTRACT

Summary. Acute lymphoblastic leukemia (ALL) is the most common form of malignancy in children. Recently, many studies have examined factors influencing both the susceptibility to ALL and the metabolism of widely used chemotherapeutic agents. These factors include, among others, single nucleotide polymorphisms (SNPs) in various genes, such as the gene encoding for methyletetrahydrofolate reductase (MTHFR), which has been proved polymorphic at the nucleotide positions 677 and 1298. Thirty-five children with ALL and 48 healthy adults of Cretan Origin, were genotyped for the presence of the MTHFR 677 and 1298 SNPs. The possible correlation of the polymorphisms with the risk for ALL and the presence of methotrexate-induced toxicities were examined. No significant association between the MTHFR genotypes and the susceptibility to ALL was observed. A borderline statistically significant relationship was detected after the methotrexate administration, between the C677T genotype and leukopenia (p=0,050) and between the A1298C genotype and normal AST and ALT values (p=0,065 and p=0,053 respectively), which was strengthened for AST, after grouping the A1298A and A1298C genotypes together (p=0,039). In our population the MTHFR C677T and A1298C polymorphisms are related with hematologic toxicity and hepatotoxicity respectively and could be suggested as prognostic factors for these adverse events.

INTRODUCTION

Acute lymphoblastic leukemia (ALL) in children represents the most frequent form of malignancy accounting for 25-30% of all cancer cases among children. The disease-free survival of childhood ALL has improved over the last years, exceeding 80% in the developed countries. This fact is attributed mainly to the improved classification and treatment of the disease which is based on known prognostic factors such as clinical and immunophenotypic characteristics and lately also relies on molecular markers based on methods of molecular analysis. Those methods reveal the role of the activation of proto-oncogenes, structural chromosomal defects such as translocations and gene fusions and are being widely used in order to establish an improved classification and estimation of prognosis of the disease. Despite the advances, almost 20% of the children with ALL either relapse or do not respond to treatment (1). This seems to be related to various parameters, including the presence of polymorphisms which may alter the activity of drug metabolizing enzymes, hence influencing the efficacy and the toxicity of therapy. Recently, attention has been drawn on genes involved in diverse metabolic pathways, which are known to be polymorphic at various sites and can affect both the susceptibility for leukemia and the treatment outcome of ALL (2).

Several studies have already revealed an association between polymorphisms located in genes which are involved in metabolic pathways and affect both the risk and the treatment outcome of the disease. Attention has been focused on polymorphisms located in genes which are involved in folate homeostasis and have been proved polymorphic. A main enzyme studied is the methylenetetrahydrofolate redustase (MTHFR) which converts 5, 10 methylenetetrahydrofolate (5, 10-MTHF) into 5-methyltetrahydrofolate (5-MTHF). 5-MTHF constitutes the major circulating form of folate. A common polymorphism in the MTHFR gene is the C→T transition at nucleotide 677 (C677T) which results in an alanine to valine substitution at the codon 222 leading to a decrease in the enzymatic activity (3). Another polymorphism in the MTHFR gene is the A→C transversion at position 1298 which causes the replacement of glutamate by alanine at the codon position 429. The MTHFR 1298 single nucleotide polymorphism (SNP) leads to a decrease in the activity of the enzyme, in the carriers of the homozygous variant (C1298C) genotype and also, to a lesser degree, in the carriers of the heterozygous variant (A1298C) genotype (4). The SNPs mentioned above influence to an extent not only the susceptibility to ALL, but also the patient's response to methotrexate (MTX) which is a drug commonly used in the treatment of ALL and has an effect on the folate metabolic pathway and thus in DNA synthesis. The adverse events presented in children with ALL during the administration of MTX are an important factor of mortality and for this reason, the association between the chemotherapeutic agent and the MTHFR polymorphisms has also been investigated (5).

The presence of the MTHFR C677T and A1298C polymorphisms among children with ALL and healthy controls with Cretan origin, was examined in this study and a comparison between the children's and the controls' genotype and allele frequency distributions was also performed. Moreover, the association between the MTHFR SNPs and the presence of treatment-related mucositis, hepatotoxicity and hematological toxicity was studied.

MATERIALS AND METHODS

Patients and Controls

The patients enrolled in the study were 35 children (14 females, 21 males-median age 6,33 years) with ALL who were diagnosed and treated in the Department of Pediatric Hematology-Oncology from 1996 until 2002. The children were aged less than 18 years at the time of diagnosis and their characteristics are presented in table I. The study was in accordance with the Helsinki Declaration of 1975 and approved by the Ethics Committee of the University Hospital of Heraklion.

The control group consisted of 48 healthy adult blood donors, who had no history of malignancy and were not receiving any treatment at the time of the blood sample collection. Both the children with ALL and the healthy adults were of Cretan origin (having both of their parents born in Crete) and were born in Crete. Clinical and demographic data were obtained from medical records, regarding the children with ALL while the origin of the blood donors was established through a questionnaire that they completed, prior to the collection of the samples.

TABLE I-Characteristics of ALL patients

GENDER

AGE

RISK GROUP

FAB

WBC at diagnosis

14 ♀

21 ♂

30 pts.<10 years old

5 pts.>10 years old

24 Standard risk

11 High risk

31 B-ALL

4 T-ALL

30 <50000 μl-1

5 >50000 μl-1

Medical Data

In order to establish the presence of adverse events in the children treated for ALL, data were used from their medical records. During the consolidation phase of the ALL-BFM 95 protocol, the presence of hematological toxicity and hepatotoxicity was established from the average values of hemoglobin, platelets and white blood cells (HGB, PLTs and WBC) regarding the former and the average values of aspartate transaminase, alanine transaminase and gamma-glutamyltransferase (AST, ALT and GGT), regarding the latter. The laboratory values were each time calculated one week after the administration of iv methotrexate. Using the Common Terminology Criteria for Adverse Events v4 from the National Cancer Institute (6), children with normal laboratory values and no stomatitis, were labeled as having no presence of an adverse event, while children with toxicity grades 1-4, were labeled as having an adverse event. The clinical records for 3 of the children were incomplete and they were not included in the statistical analysis for the methotrexate-induced toxicities.

MTHFR Genotyping

Genomic DNA was extracted from the population that participated in the study. DNA from the children with ALL was obtained by cytospin slides. Cells were carefully removed by scraping from a single touch or scrape preparative slide with the aid of a new sterile surgical knife blade and the material obtained was placed in new sterile 1.0 ml Eppendorf microtube. The cells were homogenized with the use of proteinase K and in the next step DNA was sequestered from the proteins and the lipids with chloroform. DNA was precipitated in ethanol and resuspended in water for injection. The DNA concentration was estimated with the use of a phasmatophotometer. DNA from the healthy adults was extracted from peripheral blood, using a commercial DNA-extraction kit.

The presence of the MTHFR 677 polymorphism was screened using polymerase chain reaction/restriction fragment length polymorphism (PCR/RFLP) based approaches (7). The following primers were used: 5' TGAAGGAGAAGGTGTCTGCGGGA 3' (5΄→3΄ forward) and 5' AGGACGGTGCGGTGAGAGTG 3' (5΄→3΄ reverse) (PCR product of 198-bp). The PCR products were digested with the restriction enzyme HinFI, the digestion products were then subjected to electrophoresis in 3% agarose gel and alleles were evaluated according to band size. Regarding the A1298C SNP, genotyping was performed as previously described by Wiemels et al., by PCR/RFLP techniques (8). The following primers were used: 5' GCAAGTCCCCCAAGGAGG 3' (forward) and 5' GGTCCCCACTTCCAGCATC 3' (reverse) (PCR product of 145-bp). The enzyme MboII was used for RFLP reactions and the products were subsequently electrophorised in 4% gel. Control samples were always used from homozygous and heterozygous individuals during the RFLP procedures.

Statistical Analysis

The x2 criterion was used to compare the observed numbers of each genotype with those expected for a population in Hardy-Weinberg equilibrium. The chi-square test was performed in order to examine the differences in the genotypes' frequencies between children with ALL and controls, as well as the possible correlation between the genotypes and the methotrexate-induced toxicities. The level of significance was set to 0.05. Results with p-value greater than 0.05 and less than 0.10 were considered borderline significant. Exact methods were considered preferable whenever expected numbers in any cell were less than five and all p-values were two-sided. Statistical analysis was performed with the use of SPSS (Statistical Package for the Social Sciences) software v. 17.0.

RESULTS

The PCR/RFLP reactions were successful for all samples. In order to examine the possible association of the MTHFR SNPs and ALL, a comparison of the genotype and allele frequency distributions between children with ALL and controls, was performed. No deviation from Hardy-Weinberg (HW) equilibrium was observed neither for the MTHFR 677 polymorphism, nor for the MTHFR 1298 polymorphism, both in cases (PHWALL-677=1,00, PHWALL-1298=0,94) and controls (PHWCONTROLS-677=0,90, PHWCONTROLS-1298=0,90). The distribution of MTHFR 677 genotypes (table II) was as follows: cases - (CC) - 17 children, (CT) - 13 children and (TT) - 5 patients, controls - (CC) - 18 individuals, (CT) - 24 individuals and (TT) - 6 individuals, while the results for the MTHFR 1298 genotype distribution (table II) were: cases - (CC) - 4 children, (AC) - 17 children and (AA) - 14 patients, controls - (CC) - 4 individuals, (AC) - 22 individuals and (AA) - 22 individuals. The genotype and allele frequencies, regarding both SNPs in cases and controls, did not show any statistical differences (MTHFR 677: p=0.500 and p=0. 537 respectively), (MTHFR 1298: p=0.850 and p=0.546 respectively).

We also evaluated the association between the MTHFR genotypes and the presence of stomatitis, hematological toxicity, as it was expressed by the HGB, PLTs and WBC grades and hepatotoxicity, as it was expressed by the AST, ALT and GGT grades (table III). The statistical analysis showed that there was a statistically borderline significant association between the carriers of C677T genotype and the decrease in the WBC count after the iv administration of methotrexate (p = 0,050), while HGB, PLTs, AST, ALT and GGT values were not associated with any genotype. Statistically significant differences were not established between the presence of stomatitis and the MTHFR 677 genotypes. Results shown in table III, revealed a marginally significant correlation between the A1298C genotype and normal AST and ALT values during the course of treatment (p=0,065 and p=0,053 respectively). The remaining adverse events were not associated with the presence of MTHFR 1298 genotypes.

Taking into account the fact that heterozygotes show residual MTHFR activity, we further grouped the patients in 2 categories, comparing homozygous wild-type and heterozygous children with children homozygote for the mutant allele (MTHFR 677: CC-CT vs TT), (MTHFR 1298: AA-AC vs CC). Regarding the MTHFR 677 SNP (table IV), no significant relationship was established between the two genotype categories and the occurrence of the adverse events that were documented. On the other hand, the results for the A1298C polymorphism (table IV), showed a statistically significant non-predisposing role of the A allele (A1298A+A1298C) regarding hepatotoxicity, as expressed by AST values (p=0,039).

TABLE II- Genotype and allele frequencies of MTHFR 677&1298 SNPs in cases and controls

GENOTYPES

MTHFR 677

GROUP

n

(%)

P value

GENOTYPES

MTHFR 1298

GROUP

n

(%)

P value

ALL

CONTROLS

ALL

CONTROLS

CC

17

(48,6%)

18

(37,5%)

0,500

CC

4

(11,4%)

4

(8,3%)

0,850

TT

5

(14,3%)

6

(12,5%)

AC

17

(48,6%)

22

(45,8%)

CT

13

(37,1%)

24

(50,0%)

AA

14

(40,0%)

22

(45,8%)

ALLELES

MTHFR 677

ALL

CONTROLS

P value

ALLELES

MTHFR 1298

ALL

CONTROLS

P value

C

47

(67,1%)

60

(62,5%)

0,537

C

45

(64,3%)

66

(68,8%)

0,546

T

23

(32,9%)

36

(37,5%)

A

25

(35,7%)

30

(31,3%)

TABLE III- Association between MTHFR 677 genotypes and the presence of adverse events

ADVERSE EVENTS

GENOTYPES MTHFR 677

n

(%)

P value

(Fisher's Exact Test)

MTHFR 1298 GENOTYPES

n

(%)

P value

(Fisher's Exact Test)

CC

TT

CT

AC

AA

CC

HGB

(anemia)

NO TOXICITY

6

(35,3%)

2

(40%)

2

(20%)

0,669

5

(33,3%)

3

(23,1%)

2

(50,0%)

0,578

TOXICITY

11

(64,7%)

3

(60%)

8

(80%)

10

(66,7%)

10

(76,9%)

2

(50,0%)

PLTS

NO TOXICITY

6

(35,3%)

3

(60%)

2

(20%)

0,361

4

(26,7%)

5

(38,5%)

2

(50,0%)

0,669

TOXICITY

11

(64,7%)

2

(40%)

8

(80%)

11

(73,3%)

8

(61,5%)

2

(50,0%)

WBC

NO TOXICITY

6

(35,3%)

2

(40%)

0

(0,0%)

0,050

3

(20%)

3

(23,1%)

2

(50,0%)

0,464

TOXICITY

11

(64,7%)

3

(60%)

10

(100,0%)

12

(80%)

10

(76,9%)

2

(50,0%)

AST

NO TOXICITY

13

(76,5%)

3

(60%)

8

(80%)

0,732

13

(86,7%)

10

(76,9%)

1

(25%)

0,065

TOXICITY

4

(23,5%)

2

(40%)

2

(20%)

2

(13,3%)

3

(23,1%)

3

(75%)

ALT

NO TOXICITY

14

(82,4%)

3

(60%)

7

(70%)

0,630

14

(93,3%)

8

(61,5%)

2

(50,0%)

0,053

TOXICITY

3

(17,6%)

2

(40%)

3

(30%)

1

(6,7%)

5

(38,5%)

2

(50,0%)

GGT

NO TOXICITY

14

(82,4%)

3

(60%)

8

(80%)

0,628

13

(86,7%)

8

(61,5%)

4

(100,0%)

0,184

TOXICITY

3

(17,6%)

2

(40%)

2

(20%)

2

(13,3%)

5

(38,5%)

0

(0,0%)

STOMATITIS

NO TOXICITY

5

(29,4%)

1

(20%)

1

(10%)

0,720

4

(26,7%)

3

(23,1%)

0

(0,0%)

0,719

TOXICITY

12

(70,6%)

4

(80%)

9

(90%)

11

(73,3%)

10

(76,9%)

4

(100,0%)

TABLE IV-Adverse events and combined MTHFR 677&combined MTHFR 1298 genotypes

ADVERSE EVENTS

COMBINED MTHFR 677 GENOTYPES

n

(%)

P value

(Fisher's Exact Test)

COMBINED MTHFR 1298 GENOTYPES

n

(%)

P value

(Fisher's Exact Test)

CC-CT

TT

AA-AC

CC

HGB

(anemia)

NO TOXICITY

8

(29,6%)

2

(40%)

0,637

8

(28,6%)

2

(50%)

0,572

TOXICITY

19

(70,4%)

3

(60%)

20

(71,4%)

2

(50%)

PLTS

NO TOXICITY

8

(29,6%)

3

(60%)

0,310

9

(32,1%)

2

(50%)

0,593

TOXICITY

19

(70,4%)

2

(40%)

19

(67,9%)

2

(50%)

WBC

NO TOXICITY

6

(22,2%)

2

(40%)

0,578

6

(21,4%)

2

(50%)

0,254

TOXICITY

21

(77,8%)

3

(60%)

22

(78,6%)

2

(50%)

AST

NO TOXICITY

21

(77,8%)

3

(60%)

0,578

23

(82,1%)

1

(25%)

0,039

TOXICITY

6

(22,2%)

2

(40%)

5

(17,9%)

3

(75%)

ALT

NO TOXICITY

21

(77,8%)

3

(60%)

0,578

22

(78,6%)

2

(50%)

0,254

TOXICITY

6

(22,2%)

2

(40%)

6

(21,4%)

2

(50%)

GGT

NO TOXICITY

22

(81,5%)

3

(60%)

0,296

21

(75%)

4

(100,0%)

0,552

TOXICITY

5

(18,5)

2

(40%)

7

(25%)

0

(0,0%)

STOMATITIS

NO TOXICITY

6

(22,2%)

1

(20%)

1,000

7

(25%)

0

(0,0%)

0,552

TOXICITY

21

(77,8%)

4

(80%)

21

(75%)

4

(100,0%)

DISCUSSION

The steady improvement of the cure rates in childhood ALL constitutes a major achievement of Pediatric Hematology-Oncology. The rising disease-free survival since the 1960s is mainly attributed to the improved use of existing chemotherapeutic agents and their better combination that is being established through multi-centered clinical studies. The improved classification of patients in risk groups that will lead to the possibility of individualized therapy is a major goal in the field of research. An important factor under study in this effort, is the association between genetic variations, such as single nucleotide polymorphisms and the risk of leukemogenesis, as well as the effect of various SNPs in the metabolic pathway of commonly used anticancer agents.

The role of the most common MTHFR polymorphisms (C677T and A1298C) in the susceptibility of ALL in children from Crete was examined in this study. Thirty-five children and forty-eight healthy adults were genotyped with the use of PCR/RFLP reactions for the presence of MTHFR 677 and 1298 polymorphisms. Regarding the 677 SNP, the frequencies shown here are similar to those previously reported in the Greek population (9, 10), while there is a difference with a previous study which examined the same SNP in children with Cretan origin (11), a fact that could occur due to the difference in the sample size of the two studies.

The comparison of the genotype and allele frequencies between cases and controls indicated that MTHFR 677 SNP showed no association with an increased susceptibility for ALL in Cretan children. This conclusion is in agreement with previously reported studies in pediatric populations from Europe (12, 13). Our findings are not in accordance with a study in children from northern Greece (9), where the authors reported a protective effect of the MTHFR677T allele in the childhood ALL. This difference could be attributed to various factors, including possible gene-gene interactions, the sample size or coincidence. The protective role of MTHFR677T allele was also established from Wiemels et al (8) and Krajinovic et al (14), an observation that could be due to the fact, that a large number of the children who participated in the Canadian study, were born before the implementation for additional folate supplementation during pregnancy, as the further stratification of patients showed.

We also investigated the putative association between the presence of adverse events due to methotrexate use and MTHFR 677 genotypes. Our results showed a statistically borderline significant relationship between leukopenia and the C677T genotype (p=0,050), a fact that could be attributed to the greater decrease in the catalytic activity of the MTHFR enzyme for the heterozygotes. This conclusion is in partial agreement with results from Ongaro et al who studied the effects of SNPs in folate metabolizing enzymes in an adult population (15). On the other hand, no correlation could be established between the remaining toxicities examined and carriers of CC, CT or TT genotypes. Our results differ from those reported from studies in Japan, USA and Australia (16, 17, 18), which showed that MTHFR 677 genotypes were not associated with toxicity risk. Kantar et al, after screening 37 children from Turkey with ALL or non-Hodgkin lymphoma, also showed that MTHFR 677 genotypes did not affect the presence of toxicities, a result that could be attributed to the different dose of MTX administrated (19). Moreover, Chatzidakis et al (9) showed that the C677C genotype was linked with lower ALT values during the course of the chemotherapy, a conclusion that was not in line with the results from the current study.

As far as the 1298 polymorphism is concerned, the frequencies found in our study were similar to those previously reported in a Greek population (20) and in a population from Portugal (12). No statistically significant correlation was shown between cases and controls regarding genotype and allele frequencies (p=0,850 and p=0,546 respectively-table II). This leads to the conclusion that the MTHFR 1298 SNP does not affect the ALL susceptibility in our population, as is the case in similar studies concerning children with ALL from Portugal and Germany (12, 13). Our conclusion is in agreement with the result of a meta-analysis which showed that MTHFR polymorphisms do not affect ALL risk in children (21).

However, a study conducted in UK (8) showed that the C1298C genotype had a protective effect on the risk of ALL, a fact that was attributed to the disruption in folate metabolic pathway due to the polymorphism. A meta-analysis performed by Zintzaras et al showed that the C allele protected Caucasian populations from developing ALL (22). The reported results reveal the diversity in the studies examining the role of MTHFR 1298 polymorphism in various populations, suggesting that gene-gene interactions and environmental factors, such as individual folate status, may play a role in the correlation between the SNP under investigation and ALL susceptibility.

The association between adverse events caused by the administration of methotrexate and MTHFR 1298 polymorphism in our population, was also examined. The A1298C genotype showed a statistically borderline significant non-predisposing role regarding hepatotoxicity, as expressed by the plasma values of AST and ALT (p=0,065 and p=0,053 respectively). Further stratification of patients in two categories strengthened the result (p=0,039), concerning the positive association between AST values and A1298C (AC+AA) patients. This result could be attributed to the decrease observed both in enzyme activity in heterozygotes (14) and in the methotrexate sensitivity in patients bearing the previous genotypes and especially A1298C, as studies in children from West Europe (23) and in adults from Italy (15) revealed. Results from similar studies that took place in Japan (16) and in U.S.A (17) did not report any association between the MTHFR 1298 polymorphism and the risk of toxicity. However in a study conducted in Turkey, the authors showed that patients with A1298C (AC, CC) polymorphism, presented grade III/IV anemia, decreased platelet count, increased plasma levels of AST and febrile episodes with neutropenia (19). Since our study sample is numerically similar to the one screened in Turkey, differences in the results could be explained by the dose of methotrexate and/or in dietary folate intake.

A future challenge in the field of Pediatric Hematology-Oncology is the further increase in the number of children with ALL, that are cured. This task requires large patients cohorts in both national and international level. An important target of the following years is the individualization of treatment in children with ALL, a goal in which the patient's genetic background will be of great importance. The rather small size of cases screened in our study should result in a careful view of our conclusions. However, taking into account that the patients examined here create a homogenous closed population, the possible association between the MTHFR 677 SNP and hematologic toxicity, as it is expressed by low values of WBC and the non-predisposing effect of the A1298C polymorphism regarding hepatotoxicity in children from Crete could be the basis for the further evaluation of this correlation and the studying of gene-gene interactions that affect the ALL susceptibility and the course of the treatment in our population.

AKNOWLEDGEMNT

We would like to thank Dr. Despoina Choumerianou for her technical assistance.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.