Cellulose Acetate Gel Electrophoresis Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

CHAPTER 3

D- glucose 6-phosphate barium salt hydrate (G6P) (G7125), Nicotinamide Adenine Dinucleotide Phosphate (NADP) (N575), Oxidised glutathione (GSSG) (G4376) and MgCl2 (M0250) were obtained from SIGMA- Aldrich, USA. Whatman filter paper (Cat No. 1001090) was bought from Whatman international Ltd, UK.

3.1.2 G6PD Activity Assay

G6PD screening kit (OS-MMR2000-D) was purchase from R&D Diagnostics Ltd., Holargos, Greece. Normal level G-6-PD control (Cat. No. 1-66-28) and G6PD deficient control (RDC012062) was purchased from R&D Diagnostics Ltd., Greece. NaOH (5145-81), EDTA (2525), and NaCl (6533-00) were obtained from R & M Chemicals UK. 2-Mercaptoethanol (M6250) was obtained from SIGMA- Aldrich, USA.

3.1.3 Cellulose Acetate Gel Electrophoresis

Titan III SP acetate plates ( Cat No. 3023), Blotter Pads (Cat No. 5034), Haemolysate Reagent (Cat No. 5127), G-6-PD Reagent (cat no. 5620), Supre-Heme Buffer (Cat no. 5802), AA2 Hemo Control (cat No. 5328), Chamber Wicks (Cat No. 5081), Titan Gel Cham (Cat No. 4063)  were obtained from Helena, UK. Acetic acid was from Sigma-Aldrich (Cat. No. A6283).

3.1.4 DNA Extraction

Sodium dodecyl sulfate (SDS) (5041-70) and 2-Propanol (4778-50) were obtained from R & M Chemical, UK. Ethanol Absolute (Cat. No. 4102302511)  was purchased from Merck (Germany). Trizoma (T1503) and Proteinase K (P6556) was bought from SIGMA- Aldrich, USA. Ethidium bromide (10mg/ml) (Cat. No. H5041) was obtained from Promega, USA. The primers were obtained from 1st Base Laboratories Sdn Bhd, Malaysia.

3.1.5 PCR Amplification

GoTaq Flexi DNA Polymerase (M8295), 5X Green GoTaq Flexi Buffer (M891A), MgCL2 25mM (Cat. No. A351H), dNTP Mix (Cat. No. U1511) were obtained from Promega, USA. Low molecular weight DNA ladder (N3233L) was bought from New England Biolabs (USA). 100 bp DNA ladder (iLad3) was purchase from iDNA, Singapore.

3.1.6 Restriction Enzyme Digestion

The restriction Enzymes including, BclI (R0160S), Bst XI (R0113S), Hae III (R0108S), Hha I (R0139S), Hind III (R0104S), Mbo II (R0148S), Mlu I (R0198S), Mnl I (R0163S), Nde I (R0111S), NlaIII (R0125S), Pst I (R0140S), Xba I (R0145S), PVu II (R3151S) and Xho I (R0146S) were bought from New England Biolabs (USA). 20 bp DNA ladder (SM1323) were obtained from Fermentas, USA.

3.1.7 Agarose Gel Electrophoresis

Agarose (Cat No. 161-3100) was obtained from Bio-Rad, Spain. Ethidium bromide (10mg/ml) (Cat No. H5041) was obtained from Promega, USA.

3.1.8 dHPLC

pUC18 DNA Hae III digest (D 6293) was obtained from SIGMA- Aldrich, USA. Helix Column (CP28353), Helix Buffer A (0393558101) and Helix Buffer B (0393558102) were obtained from Varian Inc., USA. AmpliTaq Gold (N8080241), GeneAmp dNTP blend 10mM (N8080260) were obtained from Applied Biosystems USA.

3.1.9 PCR Purification

QIAquick PCR Purification Kit (28106) was obtained from QIAGen, Germany.

3.1.10 Software

The G6PD gene sequence was obtained from NCBI reference sequence NC_000023.9 (GenBank Genome database http://www.ncbi.nlm.nih.gov/Genbank/). Sequence of each exon was obtained from Ensembl (Transcript ENST00000393562) (http://www. ensembl.org). Primers were design and checked for each specific DNA template by using two free online programs primer-blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast) and Primer3 (http://frodo.wi.mit.edu/ primer3/). Cleavage sites in each DNA sequences for specific Restriction Enzyme (RE) were detected by the RestrictionMapper program (http://www.restrictionmapper.org/ rmhelp.html). Prediction of melting temperature for selected DNA fragments during dHPLC was performed by melting program available online at http://insertion.stanford.edu./melt.html. The sequences were aligned with the G6PD reference sequence by the blast 2 sequences program as implemented by the National Center for Biotechnology Information blast web site (www.ncbi.nlm.nih.gov/blast/). We used two computational tools F-SNP (http://compbio.cs.queensu.ca/F-SNP/) (Lee & Shatkay 2008) and FASTSNP (http:// fastsnp.ibms.sinica.edu.tw) (Yuan et al. 2006) to find putative functional SNP in 3'UTR of G6PD gene. The RegRNA program (http://regrna.mbc.nctu.edu.tw/) (Huang et al. 2006) and MicroInspector (http://bioinfo.uni-plovdiv.bg/microinspector/) (Rusinov et al. 2005) was utilized to identify the miRNAs binding sites inside 3´UTR of G6PD gene. Secondary structures of the full-length of G6PD mRNA and as well, 3´UTR was predicted using GeneBee (http://www.genebee.msu.su/genebee.html) and mFold (http://mobyle.pasteur.fr/cgi-bin/portal.py) (Zuker et al. 1999). The program RNAhybrid (http://bibiserv. techfak.uni-bielefeld.de/cgi-bin/rnafold_submit) (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy hybridisation of mRNA and miRNA.

3.2 Methods

3.2.1 Ethical Considerations

Informed consent was obtained from all participants or their parents. The study was reviewed and approved by the institutional review boards at the HUKM ethics Committee (FF-200-2008).

This study was approved by the HUKM ethics Committee (FF-200-2008) and informed consent was obtained from all subjects or their parents prior to blood collection.

Sample size

3.2.2 Subjects (Study Population)

For the first part of the study, a population screening performed on 600 Negrito. They were 300 males and 300 females. Screening was conducted in five villages in 3 states of Malaysia including Kedah, Kelantan and Perak (Table 1). It took place between November 2004 and November 2009. The study group was males and females which selected randomly with ages ranging from 1 to 77 years old. At least, a three-generation pedigree is obtained to be sure there is no mixed marriage.

Table 1 Demographic details of each sub-tribe and study sites

Tribe Total population Village/ State for sample collection

Kensiu 240 Kg Lubok Lelong, Baling, Kedah

Kintak 132 Kg Bukit Asu, Grik, Perak

Lanoh 349 Kg Air Bah, Grik, Perak

Jahai 2075 Pos Sg Rual, Jeli, Kelantan

Bateq 1842 Pos Lebir, Gua Musang, Kelantan

For the second part of the study, informed consent was obtained and then 2-10 ml of whole blood was collected in EDTA tube from G6PD deficient and other Negrito volunteers. The blood samples were packed in ice and transported to the laboratory in UKM. A series of 45 non-aboriginal volunteers were selected as the reference group and informed consent was obtained. Then 5 ml blood was collected during UKM Convocation, UKM Bangi.

Inclusion Criteria and Exclusion Criteria

3.2.3 Florescent Spot Test

The modified protocol of Beutler's Fluorescece spot test was performed (Beutler & Mitchell, 1968). Briefly, fresh blood (finger-prick) was applied immediately to the filter paper and dried with hair drier. The dried blood spot was punched out into 5-mm diameter. One hundred microliter of assay reaction (containing 0.01M G6P, 0.0075 M NADP, 0.008M GSSG with ratio of 1:1:1) was added together with a disk of dried blood into 96 well plates. After 30 min incubation at 37° C, a sample of 10 µl was applied to the new Whatman paper. The filter paper was dried and analyzed under long wave UV light (254/366 nm) by using a Hand Held UV Lamp (Model UVGL-58, UVP, USA) in a dark room. The results were categorized into three groups: bright fluorescence, weak fluorescence, and no fluorescence. Three independent experiments were carried out for each subject with one day interval between experiments.

3.2.4 G6PD Activity Assay

The OSMMR2000 G-6-PD screening kit (R&D Diagnostics Ltd., Holargos, Greece) was used. This kit is employing the Hemoglobin (Hb) Normalization procedure invented and recommended by the manufacturer. Briefly, 5 µl of whole blood was places in a clean 96-well-U bottom microplate (elution microplate). Five microliters of control (commercial control) also was added in one of the well. Then, 75 µl of Elution Buffer (supplied by the kit) was added in each well, the contents of each well mixed properly and it was placed in a plate shaker-incubator at 37°C for 8 minutes (elution stage). In a new 96-well- U bottom microplate, 75 µl of fresh Reagent Vial (supplied by the kit) was added to each well (reagent microplate). The reagent microplate was slowly warm up to 37°C. Once elution stage was over, 15 µl of each eluted sample was transferred to the corresponding well of the reagent microplate, mixed properly. Immediately, one single reading at 405 nm was taken (Hb evaluation). Then, microplate was transfer to shaker incubator for 10 minutes. After that, 100 µl of Color Reagent (supplied by the kit) was added per well and mixed gently. The microplate was placed in a microplate reader (………model..). The reader was set to endpoint mode at 550 nm and then two reading was taken at time 0 and 10 minutes. The total ΔOD for each sample and control was calculated. The following formula was used to express the G6PD level in U/g Hb

G6PD activity assays were performed according to the WHO-recommended standard test (Betke et al., 1967) with a minor modification. Two ml of citrated blood was washed with cold normal saline 3 times with removal of buffy coat (washed red cells). Then 50 µl of the washed red cells was lysed by mixing with 950 µl ddH20 (lysed red cells). Lysed red cells were centrifuged at 3000 rpm (5000g) for 20 minutes. The hemolysate supernatant was used for G6PD enzyme activity. Fifty microliter of the hemolysate supernatant was added to a 950 µl assay containing buffer (0.1 M Tris-HCl pH 8.0, 10 mM MgCl2), 0.6 mM G6P, 0.2 mM NADP. The rate of NADPH generation was measured at 405 and 340 nm at 30oC for 10 minutes. The average change of optical density per minute was calculated to determine activity of the G6PD enzyme. The G6PD activity was calculated and reported as IU per gram hemoglobin (g Hb). G6PD deficiency was identified when the activity is less than 1.5 IU/g Hb (WHO, 1967).

3.2.5 Cellulose Acetate Gel Electrophoresis

Two hundred microliters of whole blood sample was centrifuged to obtain packed red blood cells. In a new microtube, 10μl packed red blood cells was added to 30 μl Haemolysate Reagent (Supplied by the kit) and mixed gently. Using a Microdispenser and Super Z Sample Well plate, 5μl of each haemolysed sample was placed into a pre-wet cellulose acetate plate (Supplied by the kit). In each plate, a normal haemolysed sample was also placed as control. The plate, cellulose acetate side down, quickly was placed in the electrophoresis chamber and run for 45 minutes at 140 volts. Two minute before completion of electrophoresis, a pre-wet cellulose acetate plate was sited on a clean glass Development Slide and 1.5 ml G6PD Reagent (supplied by kit) was pipette onto the cellulose acetate surface (this was called substrate plate). Then, the sample plate from electrophoresis chamber was layered with substrate plate and was incubated at 37°C for 20 minutes. At the end of the incubation period, the plates were removed from incubator. The sample plate was separated from substrate plate and preserved by soaking it in 5% acetic acid for 5 minutes. Then, it was blotted and visually inspected for the enzyme bands. A picture of the plate was obtained by using Canon scanner for later reference.

3.2.6 DNA Extraction

DNA was extracted by using Salting Out method (Miller, Dykes, & Polesky, 1988). Briefly, 5 ml of whole blood (collected in EDTA) was transfer into a 15 ml centrifuge tube and was spun for 10 min at 3000 g at 4°C. By using a plastic Pasteur pipette, plasma was carefully removed. Then 10 ml of cold distilled water was added, mixed properly and spun at 3000 g for 15 min at 4°C. The supernatant was discarded and the plate was washed with cold distilled water two times more. The pellet from third wash was re- suspended in 4.5 ml of lysis buffer (Nacl 150mM Tris15 mM, EDTA 10 mM, PH7.5). Two hundred and fifty microliters of SDS 10% and 0.1 μl of Proteinase K (containing 0.1mg) was added and mixed gently. The tube was incubated at 37°C in a water bath overnight. One thousand six hundred microliters of 5M NaCl was added to the tube, mixed thoroughly and then spun at 3500 g for 25 min at 4°C. The supernatant was transferred to a new test tube and then 5 ml of ice-cold 100% Isopropanol was added to precipitate DNA by gentle inversion of the tube. DNA was observed as a fibrous lump which transferred to a microtube and washed by 3 ml of 70% ethanol two times. DNA was air dried and approximately 250 μl of TE was added. DNA concentration was measured by reading the OD of an aliquot of diluted DNA (1 μl DNA and 49 μl of TE) at 260 nm by using BioPhotometer (Eppendorf, Germany). The DNA samples were divided to 3 aliquots and stored each one at 4, -20 and -80 °C respectively.

3.2.7 Estimation of DNA Concentration and Purity

Quantification of DNA was done using UV spectrophotometer (Eppendorf, Germany). Absorbance readings were taken at 260 nm to calculate the concentration of DNA in the samples. To determine the purity of the DNA samples, absorbance reading at 280 and 230 nm were taken.

The concentration of samples was calculated by using the following formula:

DNA concentration (µg/ml) = (OD 260) x (dilution factor) x (50 µg DNA/ml)/(1 OD260 unit).

The integrity of DNA was determined by electrophoresis through a 1% agarose gel (Farrell 1998). Briefly, agarose gel was prepared by dissolving 1g agarose in 100 ml 1X TAE (Appendix D) using a microwave oven, when the gel cooled to 55-60 °C, the gel cast and allowed to set. Three micro liters of each DNA and 3 µl of DNA ladder (0.1µg/µl) was loaded side by side and electrophoresed in 1 X TAE Buffer at 80 v for 1 hour at RT. After electrophoresis, the gel was stained in 10 µg/ml ethidium bromide in deionized water for 45 minutes and de-stained in water for 10 minutes. The quality of samples was visualized by Ultraviolet (UV) light and photographed by gel documentation system (Alpha Innetech, CA).

3.2.8 PCR-RFLP for Thirteen known Mutations

Primer Design

The G6PD gene sequence was obtained from NCBI (reference sequence NC_000023.9). Sequence of each exon was obtained from ENSEMBL (Transcript ENST00000393562). The oligonucleotides used as primers were either designed by online primer-BLAST program or obtained from published data (Kurdi-Haidar et al. 1990). Primer-Blast designed the primers and BLAST them against the Homo sapiens genome to check the primers specificity to the DNA template. The BLAST results showed that all primer sets are good enough for PCR reaction, but no any other non-specific amplicons were predicted. Oligonucleotide primers used in this study were custom synthesized by First BASE Laboratories Sdn Bhd, Malaysia.

PCR Amplification

PCR amplification was done for 13 regions of G6PD gene from exons 2-13 for 13 recognized mutations by using specific primer sets for each reaction (Table 2). Twelve mutations out of 13 were selected based on their high frequency in three most prevalent ethnic groups in Malaysia, namely Malay, Chinese and Indian or other Southeast Asia populations. These mutations are known as Viangchan, Mediterranean, Mahidol, Canton, Gaohe, Coimbra, Andalus, Orissa, Union, Chatham, Kaiping, and Vanua Lava. Assuming their African origin, the African A- mutation was selected for molecular study. The 50-μl

Table 2 List of twelve common G6PD mutations in Malaysia and Southeast Asia with their respective nucleotide substitution, exon and primer set

Nucleotide Substituation

Variant Name

(location in Exon)

Primer Sequence

871 G >A

563 C>T

1376 G>T

1388 G>A

383 T>C

487 G>A

592 C>T

95 A>G

1361G>A

1003 G>A

1360 C>T

131 C>G

Viangchan (9)

Mediterranean (6)

Canton (12)

Kaiping (12)

Vanua Lava (5)

Mahidol (6)

Coimbra (6)

Gaohe (2)

Andalus (11)

Chatham (9)

Union (11)

Orissa (3)

F:5' TGGCTTTCTCTCAGGTCTAG-3'

R:5' GTCGTCCAGGTACCCTTTGGGG-3'

F:5' ACTCCCGAAGAGGGGTTCAAGG 3'

R:5'CCAGCCTCCCAGGAGAGAGGAAG3'

F:5' ACGTGAAGCTCCCTGACGC - 3'

R:5' TGAAAATACGCCAGGCCTCG -3'

F:5' ACG TGAAGCTCCCTGACGC3'

R:5' GTGCAGCAGTGGGGTGAACATA3'

F:5' CAC CCC AGAGGAGAA GCT C 3'

R:5' CGG GAG GGAAGGGCG GA 3'

F:5'GCGTCTGAATGATGCAGCTCTGAT3'

R:5' CTCCACGATGATGCGGTTCAA GC3'

F:5' GAGGAGGTTCTGGCC TCTACTC 3'

R:5' TTGCCCAGGTAGTGGTCGCTGC 3'

F:5' TCTAGAAAGGGGCTAACTTCTCA3'

R:5'GATGCACCCATGATGATGAATACG3'

F:5' GGA CCT GAC CTA CGG CAACA 3'

R:5' CTC GGC TGG AGA GTG ACG G 3'

F:5' CAAGAAGCCCATTCTCTC CCT T-3′

R:5' TTCTCCACATAGAGGAGGACGGCT GCC AAA GT3′

F:5' ACGTGAAGCTCCCTG ACG C 3'

R:5' GTGAAAATACGCCAGGCC TTA 3'

F:5' CAGCCACTTCTAACCACACAC CT 3'

R:5' CCGAAGTTGGCCATGCTG GG 3'

PCR reaction mixture included 35 μl of sterile HO, 2 μl MgCl2, 10 μl of 5X PCR buffer,0.5 μl of 10X dNTPs, 0.25 μl of each primer, 0.25 μl of Taq polymerase, and 2 μl of DNA extract. To increase amplification product for some amplicons, 3% DMSO was included in the PCR mixture. PCR was performed on an MJ Mini gradient thermal cycler (PTC 1148 Bio Rad, USA). Cycling conditions for PCR included: initial denaturation at 95°C for 5 minuets; 35 cycles of denaturation at 95°C 1 minute, annealing at 58°C for 1 minute, and extension at 72°C for 1 minute; followed by final extension at 72°C for 10 minutes.

Restriction Digestion.

The PCR products were digested with restriction endonucleases listed in Table 3. Enzymes were selected based on the enzyme recognition site according to the base changes in each variant. For some of the variants including Gaohe, Kaiping, Mahidol, Coimbra and Viangchan, the PCR primer sequences were modified at the underlined base positions to create restriction sites as shown in Table 3. Restriction digests were performed separately for each enzyme according to manufactures instructions (New England). Briefly, an aliquot of 10 μL of PCR product was digested overnight in a total reaction volume of 20 μL with 10 units of enzyme and the digestion buffer and deionized water. The digestion buffers for a specific enzyme were those supplied by the manufacturer. The digestion products were loaded onto 2% - 4% agarose gel (depend on the size of fragments), run approximately 90 minutes at 80V, the gels were stained with ethidium bromide and visualized with UV light. Band size was determined against a 100 bp DNA ladder.

3.2.9 dHPLC

Since PCR-RFLP could not detect any of 13 recognized variants as common mutation in the majority of the study samples, dHPLC (Helix System) (Varian Inc, USA) was used to

Table 3 Details of PCR product for each G6PD variants, corresponding restriction enzyme (RE) and fragments size for normal and mutant allele after RE treatment

Variant Name

Expected PCR Size

RE

Fragments Size (bp)

Cut (Normal) Cut (Mutant)

Viangchan

Mediterranean

Canton

Kaiping

Vanua Lava

Mahidol

Coimbra

Gaohe

Andalus

Chatham

Union

Orissa

A-

126 bp

547 bp

213 bp

227 bp

164 bp

104 bp

240 bp

198 bp

508 bp

207 bp

213 bp

352 bp

320 bp

XbaI

MboII

XhoI

NdeI

MnlI

HinIII

PstI

MluI

HhaI

BstXI

HhaI

HaeIII

NlaIII

126 106+20

377+119+26+25 277+119+100+25+26

213 192+21

227 206+21

66+27+21+20+17+13 66+48+20+17+13

104 82+22

157+83 157+63+20

198 174+24

160+300+42 160+348

78+130 78+100+30

142+45+27 187+27

107+75+66+48+11 123+107+66+45+11

320 207 +113

detect presence and location of mutation(s) in G6PD gene. In overall, 25 deficient samples was underwent dHPLC.

PCR for dHPLC

Sequence of the G6PD gene from the NCBI Genbank (NC_000023.9) was served as the reference sequence (wild type). Published primer pairs and conditions (Jiang et. Al 2006) were used to amplify the G6PD fragments comprising the 10 amplicons (Table 4). The wild type sample was randomly selected and confirmed by DNA sequencing analysis for exon 2-13 and flanking intron.

Prediction of Melting Temperature

The melting profile for each DNA fragment, the respective elution profiles and column temperature were determined using the online program available at http://insertion.stanford.edu/melt.html as described in user instruction. Briefly, under dHPLC Melt Program, the sequences, whether single or multiple were specified. Then the descriptive name was entered for each of the DNA fragment. Then, the sequence of desired fragment was entered and the sizes of PCR product and its recommended melting temperature were calculated (Figure 1)

Running the dHPLC System

Six main instrument modules including computer, autosampler oven, pump A, pump B and UV detector was switched on. Level of three main reagents including buffer A, buffer B and 20% Isopropanol was checked frequently during running time. Menu was activated and followed by SERIA on the clicking on the icon at the top of left of the monitor screen. A new folder for the samples was made each time the system was run. Then both the pumps were primed by pressing on the PRIME button in order to remove the air bubbles inside the tubing towards both pumps.

Initiation and Validation of System

The Univ50 method was activated and the system was left for about 40 minutes to warm up before running. The column temperature was set to 50°C, and the Univ50 method was then ready for use. Then, the injection needle was washed by clicking on wash icon. System was validated by using pUc18 HaeIII as standard. For this purpose, 3 µl of pUc18 HaeIII (1:2 dilution with distilled water) was analyzed using Uni50 method. A system in good condition should produce nine peaks of pUc18 HaeIII. In addition, the resolution between 0.4-0.6 for the 257 and 267 base pair peaks indicated the system was in good condition to run the samples.

Screening for Heteroduplex Samples in the Exon Region of G6PD gene

PCR product from unknown sample was mixed with PCR product from wild type sample in 1 to 1 ratio for hybridization reaction via slow re-annealing. In the other word, slow re-annealing process was performed to promote heteroduplex formation in PCR product. The PCR product was heated to 95°C and followed by slow cooling to 65°C at 1°C/min decrement for 30 minutes in a total of 25 cycles and stored at4 °C until use. After slow re-annealing process, samples were injected directly at the optimum temperature and the elution profiles of the samples were compared to the elution profiles of wild type samples. A single peak pattern for any samples at the partial denaturing temperature indicated the absence of sequence mismatch, and thus, do not contain any mutation. In contrast, samples that demonstrated a different peak pattern were considered as having the Heteroduplex mutation. All fragments which displayed a single peak in a first dHPLC run, a second analysis was done to detect possible heteroduplex alterations. Samples that showed the heteroduplex peaks were subjected to sequencing in forward and reverse direction.

Table 4 Primers and condition for amplifying coding region and flanking intron of G6PD gene for dHPLC screening

Exon

Expected PCR Size

Primer Sequence Annealing

Tm (°C)

2

3+4

5

6

7

8

9

10

11+12

13

314 bp

377 bp

361 bp

285 bp

242 bp

230 bp

332 bp

377 bp

318 bp

231 bp

F:5' GGTGTCACCCTGGTGTGAGA3′ 56

R:5' GCCCTGCAACAATTAGTTGGAA 3′

F:5' AGGATGATGTATGTAGGTCG 3′ 56

R:5' CCGAAGCTGGCCATGCTGGG3′

F:5' ACACACGGACTCAAAGAGAG3′ 65

R:5' CCCGGACACGCTCATAGAGT 3′

F:5' AGCTGTGATCCTCACTCCCC 3′ 57

R:5' GGCCAGGTGAGGCTCCTGAGT 3′

F:5' ACATGTGGCCCCTGCACCACA 3′ 58

R:5' GTGACTGGCTCTGCCACCCTG 3′

F:5' TTGGGGTCCCCATGCCCT TG3′ 58.5

R:5' TGCCTCGTCACAGATGGGCC3′

F:5' TCCCTGCAC CCC AACTCAAC 3′ 59

R:5' AGTGCGTGAGTGTCTCAG T 3′

F:5' ACTGAGACACTCACGCAC T 3′ 62

R:5' TGCCTG CCACCATGTGGA GT 3′

F:5' TGGCATCAGCAAGACACTCTCTC 3'

R:5' CCCTTTCCTCACCTGCCATAAA 3'

F:5' TGCCTCTCCTCCACCCGTCA 3' 56

R:5' CCGGGGCCAGGAATGTGCAG 3'

References: Jiang et al. 2006.

Figure 1 Example of out put from dHPLC Melt Program for exon 6

3.2.10 PCR Product Purification

QiaGene PCR Purification Kit was used to purify the PCR product. The centrifugation protocol as provided by the manufacturer was strictly followed. Five volumes of Buffer PB (supplied by kit) was added into 1 volume of the PCR product and mixed thoroughly. Then the mixture was transferred into a Spin Column (supplied by kit) and placed in a collection tube. DNA was bound selectively to a membrane in a Spin column due to the high concentration of salt in the buffer PB. The mixture was centrifuged at 12,000g for 1 minute to accelerate the process where DNA binds to the filter of the column. The flow through was discarded and the spin column was replaced into the same collection tube. A total of 0.75 ml washing buffer (supplied by kit) was added into the spin column, followed by centrifugation at 12,000g for 1 minute. Then, the flow through was discarded and spin column was placed in a clean 1.5 ml tube. Thirty microliters of deionized water added and incubated at room temperature for 10 minutes. The tube was centrifuged at 12,000g for 2 minutes, the column removed and purified PCR product stored at -20° C.

3.2.11 Automated DNA Sequencing

Amplified DNA fragments of 12 exons were prepared for sequencing using primer listed in table 4. All samples with heteroduplex picks were sent for an automated sequencing at 1st Base Laboratories Sdn Bhd, Tmn Serdang Perdana, Selangor using Sequencer for bi-directional sequencing. Cleaned fragments were sequenced from both strands using the dideoxy chain-terminator method, with V.3.1 Bigdye terminator chemistry.

3.2.12 Screening for the presence of G6PD 1311/93

dHPLC and sequencing results from randomly selected samples indicated that C1311T at exon 11 combine with IVS11 T93C (designates as G6PD 1311/93) were the common mutation in Negrito. Then two set of PCR-RFLP were designed to screening all the samples for the presence of G6PD 1311/93. Detail of these two sets of PCR-RFLP is listed in table 5 and PCR-RFLP was done following steps in sections 3.2.8.

Table 5 Details of PCR product for each G6PD variants, corresponding restriction enzyme (RE) and fragments size for normal and mutant allele after RE treatment

Variant Name

Expected PCR Size

RE

Fragments Size (bp)

Cut (Normal) Cut (Mutant)

1311

IVS11-93

207 bp

318

BclI

NlaIII

207 184+23

318 204+114 M

3.2.13 Search for the SNP in the 5´ UTR and 3´ UTR of G6PD Gene

PCR and direct sequencing of the entire 3´UTR and part of 5´UTR of the G6PD gene was done for all the Negrito and control samples. The PCR condition and details are listed in table 6

3.2.15 Statistics Analysis

Table 6

Exon

Expected PCR Size

Primer Sequence Annealing

Tm (°C)

1311

IVS11 93

3' UTR

5'UTR1

5'UTR2

204

318

397 bp

574 bp

330 bp

F:5' TGTTCTTCAACCCCGAGGAGT 3'

R:5'AAGACGTCCAGGATGAGGTGATC 3'

F:5' TGGCATCAGCAAGACACTCTCTC 3'

R:5'CCC TTTCCTCACCTGCCATAAA 3'

F:5' TCACTCCAGCCCAACAGA 3′

R:5' GGTCCTCAGGGAAGCAAA 3′

F:5'AGGCGGGGAAACCGGACAGT 3′

R:5'GTCCCCTTCGCTCTCGGGGT 3′

F:5' ACCCCGAGAGCGAAGGGGAC 3′

R:5' CGGCTGGGCATTGGGGAGTG 3′

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.