Beta Lactamase Production In Urinary Tract Infections Biology Essay

Published:

In this study, we aimed to determine the frequency of extended spectrum beta lactamase (ESBL) producing isolates. ESBL-production was tested by the double-disc synergy method and more confirmed by PCR amplification. Out of 188 isolated microorganisms Escherichia coli (80%) was most frequent. ESBL production was determined in 14.5% of clinically gram negative isolates. CTX-M type was most prevalent type (12.7%) and SHV and TEM type were in the next ranks. In conclusion, our data indicate the spread of ESBL type in clinically gram negative isolates in urinary tract samples collected from Sanandaj two general hospitals.

Keywords: Urinary tract infections; Extended-spectrum β-lactamase (ESBL); Escherichia coli,

1. Introduction

Urinary tract infection are among the most common nosocomial and community acquired infections. Information on prevailing levels of antimicrobial resistance among common pathogens associated with urinary tract infection is useful in making an appropriate choice of empiric therapy. [1]. Resistance to antibiotic treatment in patients with urinary tract infections (UTIs) is a representative example of the increasing problem of antimicrobial resistance. [2].

Lady using a tablet
Lady using a tablet

Professional

Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

Extended-spectrum β-lactamases (ESBLs) have been emerged as an important mechanism of resistance in Gram-negative bacteria(reference). Unfortunately, ESBL-producing organisms often also possess resistance determinants to other important antibiotic groups, such as aminoglycosides and fluoroquinolones, leaving an extremely limited range of effective agents. Delay in appropriate therapy for infections with ESBL producers not only prolongs hospital stay, but is associated with increased mortality [3-7]. Escherichia coli accounts for most uncomplicated UTIs. However, recent data indicate that urinary tract infections (UTIs) caused by ESBL-producing E. coli may be an emerging problem in various parts of the world [3-6, 8, 9].

The aim of this study was to characterize ESBL-producing gram negative bacteria isolated from the urine of patients based on their susceptibility to antimicrobial agents.

2. Materials and methods

2.1. Study population and specimen types

This study was conducted at Faculty of Medicine, Kurdistan University of Meical science, Sanandaj, Iran. From September 1st 2007 to September 1st 2008, isolates were collected from urinary tract of 301 patients who were referred for Toohid and Beesat Hospitals.

2.2. Microbiological methods

All samples were routinely cultured on MacConkey and blood agar plates. Isolates were identified at the species level using standard biochemical tests and microbiological methods. Only one isolate per patient was included in the study.

2.3. Antibiotic susceptibility testing

Disk-diffusion tests were carried out with antibiotic-containing disks on Mueller-Hinton agar plate (Merck). The results were expressed as susceptible or resistant according to the criteria recommended by the 'Clinical and Laboratory Standards Institute (CLSI) [10]. The following antimicrobial agents were tested: amikacin (30 µg), ampicillin (10 µg), cefalotin (30 µg), cefotaxime (30 µg), ceftazidime (30 µg), ceftriaxone (30 µg), ciprofloxacin (5 µg), cotrimoxazole (1.25/23.75 µg), gentamicin (10 µg), tetracycline (30 µg), ceftizoxime (30 µg), and norfloxacin (10 µg).

2.4. Detection of ESBL production

ESBL production was detected using the double-disk synergy (DDS) test [11]. ESBL presence was assayed using the following antibiotic disks (MAST, UK): cefotaxime (30

μg), cefotaxime/clavulanic acid (30/10 μg), ceftazidime (30 μg), and ceftazidime/clavulanic acid (30/10 μg). Escherichia coli ATCC 25922 strains served as positive controls.

2.5. Statistical analysis

Data were entered into a database using SPSS 11.5 for Windows (SPSS Inc., Chicago, IL). Differences between proportions were analyzed using the 2 test. All differences in which the probability of the null hypothesis was p < 0.05 were considered significant.

2.5. ESBL- PCR

Template DNA was prepared as follows: A cell pellet from 1.5 ml of overnight culture was resuspended in 500 μl of TE (10 mM Tris, 1 mM EDTA, pH 8.0) after centrifugation and boiling for 10 min. After centrifugation, the supernatant was used for PCR. The primers and conditions for PCR are listed in Table 1 [12].

Table 1. Primers and conditions of polymerase chain reaction used in this study

Primer

PCR primers (5'→3')

Expected size (bp)

PCR conditions

PCR product

SHV-F

GGGTTATTCTTATTTGTCGC

928

94 °C, 5 min; 35 cycles of 94 °C, 1 min, 58 °C, 1 min, 72 °C, 1 min

SHV-1, -2, -5, -7, -11, -12, -18, -26, -32, -33, -38, -44, -46, -49

SHV-R

TTAGCGTTGCCAGTGCTC

TEM-F

ATAAAATTCTTGAAGACGAAA

1080

94 °C, 5 min; 35 cycles of 94 °C, 1 min, 58 °C, 1 min, 72 °C, 1 min

Lady using a tablet
Lady using a tablet

Comprehensive

Writing Services

Lady Using Tablet

Plagiarism-free
Always on Time

Marked to Standard

Order Now

TEM-1, -52, -71, -104, -105, -138, -151, -152

TEM-R

GACAGTTACCAATGCTTAATCA

CTX-M-F

ACGCTGTTGTTAGGAAGTG

759

94 °C, 5 min; 35 cycles of 94 °C, 45 s, 58 °C, 45 s, 72 °C, 1 min

CTX-M-1, -3, -12, -15, -22, -30, -32, -33, -38, -52, -57, -58, -60, -61

CTX-M-R

TTGAGGCTGGGTGAAGT

OXA-1-F

ACACAATACATATCAACTTCGC

813

94 °C, 5 min; 35 cycles of 94 °C, 1 min, 58 °C, 1 min, 72 °C, 1 min

OXA-1, -4, -30, -31, -47

OXA-1-R

AGTGTGTTTAGAATGGTGATC

OXA-2-F

TTCAAGCCAAAGGCACGATAG

814

94 °C, 5 min; 35 cycles of 94 °C, 45 s, 61 °C, 45 s, 72 °C, 1 min

OXA-2, -3, -15, -21, -32

OXA-2-R

TCCGAGTTGACTGCCGGGTTG

3. Results

We received and examined 188 urine specimens during the study period. Of these, 151(80.3%) were from outpatients and 37 (19.7%) from inpatients. The species distribution included Escherichia coli (80%), Klebsiella pneumoniae (5.3%), Pseudomonas aeruginosa (7.5%), Entero­bacter spp. (5.4%), Proteus spp. (0.5%), and Citrobacter spp. (0.5%). The high resistance rate was 51% to trimethoprim and low resistance rate 14.4% to amikacin. Table 2 summarizes the percentage of resi­stance of Gram negative bacilli isolated in this study.

Table 2. The pattern of antimicrobial resistance of urine gram-negative bacteria isolated from patients

Antibiotic resistance (% )

Bacteria

NA

TE

NOR

CT

CP

CRO

CF

AM

AN

GM

SXT

CAZ

CTX

0.00

0.00

0.00

0.00

0.00

0.00

0.00

0.53

0.00

0.00

0.00

0.53

0.53

Citrobacter freundii

19.15

35.11

14.89

10.64

17.55

20.21

17.55

38.30

5.85

13.83

39.36

22.87

22.87

E. coli

1.60

1.60

1.06

1.06

1.06

1.06

1.06

1.60

2.13

1.60

2.13

2.13

2.13

Enterobacter aerogenes

2.13

1.06

0.53

1.60

1.06

1.60

1.06

1.60

2.13

0.53

2.13

1.60

1.60

Pantoea agglomerans

1.60

1.60

0.53

0.53

0.53

0.53

0.53

1.60

1.60

1.06

1.06

1.06

1.06

Pseudomonas oryzihabitans

0.00

0.00

0.00

0.00

0.00

0.00

0.00

0.53

0.00

0.00

0.00

0.53

0.53

Klebsiella pneumoniae

2.66

1.60

1.60

1.60

1.60

1.60

1.60

1.60

2.66

2.66

5.32

3.72

3.72

Proteous mirabilis

0.53

0.00

0.00

0.00

0.00

0.00

0.00

0.00

0.00

0.00

0.53

0.00

0.00

Pseudomonas aeruginosa

0.00

0.00

0.00

0.00

0.00

0.00

0.00

0.00

0.00

0.00

0.53

0.00

0.00

Salmonella arizona

27.66

40.96

18.62

15.43

21.81

25.00

21.81

45.74

14.36

19.68

51.06

32.45

32.45

Total

CTX: Cefotaxim, CAZ: Ceftazidim, SXT: Trimethoprime-sulfamethosazole, GM: Gentamycine, AN: Amikacine, AM: Ampicillin, CF:Cefalotin, CRO: Ceftriaxon, CP: Ciprofloxacin, CT: Ceftizoxim, NOR: Norfloxacin, TE: Tetracyclin, NA: Nalidixic acid

Out of 188 Gram-negative isolates, 27 isolates were positive for ESBL (Table 3). CTX-M type was most prevalent type (12.7%) and among the isolated bacteria E. coli was high rate of ESBL production in this study.

Table 3. The rate of extended spectrum beta-lactamase types in gram-negative bacteria isolated from urinary tract infections

Microorganisms

ESBL type

CTX-M

TEM

SHV

OXA-1

OXA-2

Citrobacter freundii

0.53%

0.53%

0.53%

0.00%

0.00%

E. coli

9.57%

6.91%

8.51%

5.85%

2.13%

Enterobacter aerogenes

0.00%

0.00%

0.00%

0.00%

0.00%

Pantoea agglomerans

0.53%

0.53%

0.53%

0.53%

0.00%

Pseudomonas oryzihabitans

0.00%

0.00%

0.00%

0.00%

0.00%

Klebsiella pneumoniae

1.60%

1.06%

1.60%

0.00%

0.53%

Proteous mirabilis

0.00%

0.53%

0.00%

0.53%

0.00%

Pseudomonas aeruginosa

0.53%

0.53%

0.53%

0.53%

0.53%

Salmonella arizona

0.00%

0.00%

0.00%

0.00%

0.00%

Total

12.77%

10.11%

11.70%

7.45%

3.19%

4. Discussion

Urinary tract infections (UTIs) are one of the most frequently encountered conditions in clinical medical practice requiring antimicrobial therapeutic intervention. To date, E. coli has been the most common isolated pathogen causing UTIs[13]. In this study the 80% of isolates were was belong to this strains, followed by Klebsiella pneumoniae (5.3%), Pseudomonas aeruginosa (7.5%), Entero­bacter spp. (5.4%), Proteus spp. (0.5%), and Citrobacter spp. (0.5%). The rate of other gram negative bacteria was in accordance with other reviewed studies [14-21].

Trimethoprim-sulfamethoxazole has been successfully used for treatment of urinary tract infections [13]. However, the prevalence of resistance to trimethoprim-sulfamethoxazole among clinical isolates has been increasing; this has been shown in the present study (resistance rates, 51%). Due to the reduced activity of trimethoprim-sulfamethoxazole against E. coli isolates, fluoroquinolones such as ciprofloxacin are being used frequently as 1st-line treatment of UTIs. Resistance to norfloxacin and ciprofloxacin was 18.6% and 21.8%, respectively. In other reviewed studies from Iran the resistance rate to floroquinolons was higher than this study results[22, 23]. The results of this study confirmed reduced activity of ciprofloxacin against gram negative isolates. This finding suggests probable limitation of the use of fluoroquinolones for the treatment of these infections as a 1st-line choice. Increased resistances to the other agents reflect their wider use in urinary tract infection.

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

ESBL-producing among clinically gram negative isolates have also become a serious problem in the clinical setting[24]. In this study, overall ESBL production rate among gram negative isolates was 14.5%. ESBL-producing E. coli isolates including 10% of them. Since prior studies have reported that about 82.9% of clinical isolates were ESBL producers in Tehran[25]. Although the prevalence of ESBL-producing E. coli isolates in Asian countries are variable [26]. In considering that CTX-M-type ESBLs, the most widely spread enzymes among non-TEM and non-SHV plasmid-mediated ESBLs, the rate of this enzyme was 12.77% in this study. SHV and TEM type were in the next ranks. The CTX-M enzymes have originated from Kluyvera spp. and recently gained prominence in Enterobacteriaceae with reports from various parts of the world [5, 27-29]. Further molecular characterization of the ESBL types are needed to determine the clonal transmission of these enzymes in order to control on drug resistance in this province.

Conclusion

In conclusion, our data indicate the spread of ESBL type in clinically gram negative isolates in Sanandaj two general hospitals. The most bacterial isolate was E. coli and CTX-M type was most prevalent ESBL type. Further clinical study is required to monitor the molecular epidemiology and transmission of ESBL types in order to control the spread of drug resistance among gram negative bacteria in Community and hospitals settings.