Basic Technique Used In A Genetic Analysis Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Abstract

Various different enzymes like proteinase K and RNAse A and other toxic organic solvents like phenol/chloroform have been used before in different attempts to isolate DNA from whole blood. The use of these materials, though, could be expensive and/or dangerous in applications to researchers, thus, a new cost-effective and safe protocol that does not involve those materials would be really useful. In the current study, human whole blood samples were biological targets for genomic DNA isolation by a protocol modified from the salting-out method. The modification includes using a commercial washing powder instead of using chemical detergents and an analytical-grade enzyme. The washing powder's concentration was tested using different concentrations each time and proteins precipitation was done using NaCl-saturated distilled water. At the final step, the DNA was precipitated by 96% ethanol. The results show that DNA purity and quantity were higher at a washing powder concentration of 30mg/mL. Using that concentration in the procedure produced the final suggestion of a protocol. The protocol was carried out upon 100 blood samples, with an amount more than 50 ug/mL of whole blood. Gel electrophoresis runs were used for DNA fragments separation to confirm the bands' integrity. Those bands separated were used as DNA templates for further PCR reactions. The results showed no inhibitory materials or contaminations in the sample, which confirmed good DNA quality and purity. As a conclusion, the new procedure proved to be simple, cost-effective, accurate and safe enough to be employed in medical, clinical and diagnostic laboratories and research and production centers.

Introduction

The primary and basic technique used in a genetic analysis, like linage analysis or for detecting mutations, is the extraction of genomic DNA. The success of these diagnostic analysis methods relies mainly upon the extraction of DNA fragments without contamination or inhibitory materials with high quantity and purity.

DNA isolation consists of multiple basic steps, the first of which found in all DNA extraction methods is called cell lysing. Enzymes and agents like Proteinase K, chelating agents and detergents are utilized to make the isolation of DNA possible. The role detergents play in the mechanism is dissolving the cell membrane and denaturing any existing proteins. Proteinase K then digests those proteins while bivalent cations of nuclease cofactors are attracted and bound to chelating agents which prevent their degradation by those enzymes used. RNase A is used in some isolation techniques to get rid of any RNA contaminants in the sample. Common procedures include the use of organic solvents, like phenol/chloroform and isoamyl alcohol to purify DNA. After isolation and purification, the DNA precipitation is done using 96% ethanol, or sometimes isopropanol which is more branched and efficient for precipitation, and distilled water or a TE buffer are used for dissolving and further analysis.

The general idea is basically the same in all of the different protocols used, but some of them contain disadvantages like the use of infectious or biohazardous materials and agents that may harm the personnel working on the samples, and like time-consumption and money wasting. It is expensive to use enzymes like Proteinase K and RNase A, and not economical specially when used in high quantities to produce high purity products.

Modifications to the methods mentioned above to eliminate their disadvantages have been attempted by many researchers recently. The phenol/chloroform method involving toxic materials have been modified to produce the salting-out procedure. In this method, proteinase K is employed to treat the cell lysate overnight, and NaCl-saturated distilled water to dehydrate semidigested proteins. After that, modifications to this procedure to avoid enzymes incubations were made. In these modifications, only detergents were used to denature proteins and a 6 M NaCl solution is used for precipitation.

Recent efficient and effective methods were introduced like chromatography columns which provide a simple and accurate method for the procedure, but may not be used routinely for diagnostic tests considering the high cost involved. Thus, developing a protocol that is all efficient, simple and cost-effective seems to be difficult.

In the current study, common washing powder was used in place of analytical-grade enzymes and dangerous materials to extract genomic DNA from human whole blood samples. In previous studies that used commercial washing powders, DNA isolation was carried out upon different tissues, gels, peripheral blood. Other detergents and chemicals like EDTA were used along in those studies with washing powders that contained enzymes (like proteases) which are considered as the most important agents playing essential roles in the process of DNA isolation. On the other hand, in this current study, both enzyme-containing washing powders and multi-purpose enzyme-free washing powders were used to find that there's no difference in the results produced. The general protocol of these studies was further simplified, made short and fixed to obtain high purity, high quantity genomic DNA from relatively small amounts of human whole blood.

Materials and Methods

Using Different Washing Powder Concentrations

10 EDTA-anticoagulated blood samples were used and 5 mL of each were transferred in five 10 mL glass tubes. To each tube, 8 mL of lysis buffer (0.3 M sucrose, 0.01 M TrisHCL, pH 7.5, 5 mM MgCl2, 1% Triton X100) was added. The tubes were centrifuged at 2,500 g for 5 min. After discarding the supernatant, 300 ul of 10 mM TrisHCL (pH 8) was added on the pellets. The pellets were transferred immediately to fnew microfuge tubes. The sediment was then vigorously vortexed to resuspend, and the output was centrifuged at 700 g for 1 min. The supernatant was discarded and 330 uL of 10 mM TrisHCL (ph 8) along with 330 uL of washing powder solution (concentrations: 20,25,30,35 and 40 mg/mL) and a glass bead that was added to each tube. The samples were then vortexed for 1 min and 250 uL of 6M NaCl were added and vortexed again for 20 sec. The tubes were then centrifuged at 15,000 g for 5 min. We then transferred about 750 uL of the supernatant to new tubes and 750 uL of 96% ethanol was added to precipitate the DNA. The precipitate was collected using a heat-sealed, thin-end glass pipette, then washed two times by 70% ethanol (0.5 mL), and dissolved in 100 uL of 10 mM TrisHCL (pH 8). The DNA precipitate was then dissolved completely by incubating at 70oC for 5 min.

Determining the Purity, Concentration, and Integrity of Isolated DNA

To find out the DNA concentration and purity, the A260 and A260/A280 ratios were employed.

Extracted DNA was loaded in parallel with DNA isolated by standard salting-out procedure on 1% agarose gel to evaluate the prbablity of DNA degradation probability.

PCR

To make sure if any inhibitory material is contaminating the sample, a PCR reaction was carried out. A B-goblin gene fragment was amplified in a 25 uL reaction containing 1x PCR buffer (15 mmol/L (NH4)2SO4, 2 mmol/L MgCl2, 60 mmol/L TrisHCl, pH 8.5) 200 umol/L each dNTP, 0.125 ug each primer (forward: ACACAACTGTGTTCACTAGC L, reverse : TCATTCGTCTGTTTCCCATT), and 0.5 U Taq polymerase. In the PCR reaction, the initial denaturation was carried out at 94oC for 5 min, then 35 cycles of denaturation at 95oC for 15 sec, annealing was at 55oC for 30 sec, and the synthesis step was at 72oC for 45 sec. The final extension was at 72oC for 10 min.

Results

In the study, DNA isolation was carried out using different concentrations of washing powder, as a result, the DNA isolated was tested for its yield and quality. The results of the tests suggested that the best concentration of washing powder to be used to produce highest yield and quality ratio is 30 mg/mL. Different washing powders with different formulas were also used and no differences in purity and quantity of extracted DNA were observed.

Sometimes, red blood cells are trapped between nuclei, causing the pellet to be found red after performing cell lysing. For troubleshooting, repeating the cell-lysing step would be recommended to solve the problem. 2 mL of lysis buffer should be added to the pellet to resuspend and then centrifuge before continuing with the next steps in the protocol. Also, increasing the centrifugation time for 5 to 10 min after adding the NaCl-saturated distilled water was found to possibly increase the purity of the extracted DNA because it helps the separation of supernatant from the protein precipitate.

100 samples of human whole blood were tested for DNA extraction using the modifications mentioned above to optimize the protocol's efficiency. The average extracted DNA yield was calculated to be 56.3 +/- 7.2 ug/mL blood, and the A260/A280 ratio to calculate purity was 1.77 +/- 0.11.

The results of the gel electrophoresis run indicated the absence of any smear on the sample lane.

Gel-electrophoresis was used to visualize the results of the PCR reaction on the isolated DNA and DNA extracted with common salting-out method in parallel.

Discussion

Previously, different studies attempted DNA extraction from different targets using commercial washing powders along with biological detergents that contain proteases, which are cited to be the most essential enzymes involved in the process of DNA isolation. Nevertheless, no differences were observed in our tests comparing between results from biological and non-biological detergents. As a conclusion, we thought that one of the common chemicals within all the commercial detergents used is the one responsible for DNA isolation. Confirming that is the short 10 min incubation period after detergent addition that is not enough for the enzyme to digest its substrate. Our research for the simplest form of protocol for isolating DNA is continuing. In addition, this method may not pose as useful and cost-effective considering it is not economical to use pure chemical components from washing powders. Furthermore, other than developing a fast procedure, we were aiming to develop a cost-effective technique for DNA extraction.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.