Bacterial Transformation And DNA Identification Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

The manipulation of DNA as been greatly influenced by the range of techniques which have been developed in the last 4 decades, these tools have enabled the analysis, manipulation and detection of DNA through biological processes.

Bacterial transformation is a technique that is constantly used in a molecular biological laboratory. It involves the introduction of a foreign plasmid into bacteria, which is then used to amplify the plasmid in order to generate large quantities of the plasmid (cloning).

Cloning is the generation of multiple identical copies of a specific DNA fragment or gene; it is based principally on the natural function of plasmids to transfer genetic information which is vital for the survival of the bacteria. It can either be cell-based cloning via the use of plasmid vectors and host cells, or cell-free cloning i.e. Polymerase Chain Reaction (PCR).

Most cell-based cloning use plasmid vectors in Escherichia coli. Plasmids are typically circular double stranded DNA molecules that carry only non- essential genes but often acquire genes that are beneficial to the cell (the gene often encodes a protein which makes the bacteria resistance to an antibiotic). Plasmids often replicate independently of the organisms' chromosomes but utilise the enzymes of the organism for replication.

The critical features of plasmids are a selectable marker (a gene that encodes for antibiotic resistance), an origin of replication (the stating point for the generation of a copy of plasmid), and a multiple cloning site (usually in the middle of a reporter gene having many restriction enzyme sites).

An example of a reporter gene is Lac Z, which is one of the three genes found in Lac Operon and is the enzyme Beta-galactosidase. This is a modification on pre-existing plasmids in order to detect clones having inserted DNA fragments and the introduction of recognition sites for the restriction enzymes. These restriction sites allow the digestion of the plasmid vector with the appropriate enzyme and also the insertion of foreign DNA fragments or gene with well-matched DNA ends. The strands of the inserted and plasmid DNA(s) are then joined together through ligation. The inserted foreign DNA undergoes replication simultaneously with the rest of the plasmid DNA, thus, resulting in the generation of a large number of DNA copies.

Figure 1. Plasmid Cloning Vector pBluescript SK

After the ligation of the DNA fragments, the recombinant DNA molecule needs to be competent before it can be taken in by the bacteria. By suspending DNA in a high concentration of calcium chloride, it can be made highly competent for the bacteria to take in. this unfortunately makes the bacteria highly unstable and may lead to bacterial death, so care must be taken while carrying out this procedure.

In the 2-week Lab practical, the main objectives of the experiment were to carryout out bacterial transformation by using plasmid vector in E. coli and to amplify the plasmid for DNA identification using PCR with vector specific primers that amplifies the DNA, causing an increase in the size of product thus, indicating the inserted DNA and small scale plasmid DNA isolation, digested by appropriate restriction enzymes, and then plasmid clones with inserted DNA identification via Agarose gel electrophoresis which determined the size of the resulting fragment.

However, in contrast to results that were meant to be obtained from this experiment, the results shown from the gels in both methods indicated that there were contaminations and thus the result failed to address the final aim of the experiment.

MATERIALS AND METHODS

The materials for this experiment included competent cells which were provided, pBlueScript, and EcoR1- a restriction enzyme.

The bacterial transformation was carried out using the pBlueScript which was the positive control and the plasmid provided (plasmid 1).

Procedure:

Competent cells (200ul) were aliquot into a labelled eppendorf tube on ice and 1ul of the plasmid was then added onto it. It was incubated on ice for 20 minutes, then 42o C water bath for a minute (timing was appropriately noted). The sample was returned onto ice for 2 minutes, after which 500ul LB was then added before it was placed in a shaking incubator at 37oCfor an hour.

Two LB + Ampicillin (50ug/ml) plates were labelled for each transformation (pBluescript and Plasmid 1) and both plates had a 100ul label while the other had a 600ul label. 100ul of the sample were then put in LB + Ampicillin plates for each and were spread with a sterile spreader. All the plates were then incubated at 37oC overnight.

Polymerase Chain Reaction

In order for PCR to work, just the lysing of bacterial cells by boiling releases DNA into solution without the need for DNA isolation. The multiple cloning sites are flanked by primers which are specific for the vector sequences.

Procedure:

Four eppendorf tubes were labelled for pBluescript, plasmid 1, plasmid 2, and plasmid 3 respectively. 100ul distilled water was added to each tube. And using a sterile tip, a colony was picked from each plasmid plate with the tips placed in the appropriate eppendorf tube. The distilled water is the pipette up and down using the tips so as to re-suspend the different colonies. Eppendorf tubes were closed and the tubes were placed in a 90oC heating block for 5 minutes, after which the tubes were centrifuged for 2 minutes in order to collect the content at the bottom of the tubes.

To PCR tubes labelled for pBluescript and plamid 1, 2, 3, and the negative control respectively, 20ul PCR master mix was added as indicated in the table below.

Supernatant (1ul) from each plasmid was then added to the PCR tubes; the tubes were centrifuged and then placed in the PCR machine (thermo-cycler).

Small scale culture

To four 1.5ml eppendorf tubes labelled for pBluescript, plasmid 1, 2, and 3 exclusively, 1ml of terrific broth was added to each, after which 2ul Ampicillin (50mg/ml) was added to give a final concentration of 100u/ml. And using a sterile tip, a colony was picked from each plasmid plate and then inoculated. The lids were closed and then incubated at 37oC and shaking overnight.

For Transformation:

The plates were collected and the number of colonies on the 100ul and 600ul plates were assessed and counted. The number of plates and colonies counted were noted.

Identification/ detection of DNA

During the cloning of DNA fragments into plasmid vectors, plasmids containing inserted DNA can be identified by one of two ways. (1) PCR with vector specific primers amplifies the DNA and increase the size of the product thus indicating the inserted DNA. (2) Small scale plasmids are first isolated, and then digested with specific restriction enzymes, and the plasmids clones with the inserted DNA are then identified via the size determination of the resulting fragment using agarose gel.

DNA can be visualised using agarose gel electrophoresis; the agarose behaves like a sieve and allows smaller fragments of DNA to migrate faster than larger ones. This is how the DNA fragments are thus separated and identified (based on size). However, for the DNA fragments to be visualised, it requires staining with visible stains like methylene blue or stains that fluoresce under UV (Ultraviolet) light i.e. Ethidium Bromide.

For the PCR:

The PCR samples were collected, the DNA marker was prepared in eppendorf tube by adding 17ul sterile water, 2ul gel loading buffer, and 1ul biotinylated DNA marker. The gel was then loaded as follows (20ul per lane) and electrophoresis was done at 100V for 30 minutes, this was followed by the visualisation of the gel on Gel documentation devise.

Lane

Sample

1

pBluescript

2

Plasmid 1

3

Plasmid 2

4

Plasmid 3

5

DNA markers

6

-DNA

For small scale plasmid:

Plasmid DNA mini preparation: the plasmid DNA was prepared from a liquid culture as follows; the bacterial culture was collected and the tube was centrifuged for 2 minutes (10,000 rpm). Then the culture medium was removed and cell pellet was re-suspended in 100ul of solution I (Tris, EDTA buffer) by vortexing. 200ul solution II (NaOH, SDS - lysing) was added; the tube was inverted several times to allow them to mix and placed in ice for 5 minutes. 150ul of solution III (Acetate- cloudy formation) was added and the tube was inverted several times to allow them to mix. The tube was centrifuged in order to pellet proteins and chromosomal DNA before the supernatant was then transferred to fresh 1.5ml eppendorf tube. 450ul of isopropanol (for precipitation) was added and the tube was inverted several times to mix and then centrifuged for 2 minutes, 10,000rpm to pellet DNA (visible pellet). The supernatant was removed, 70% ethanol (300ul) was added in order to wash off the excess salt, and it was then centrifuged for 1 minute, 10000 rpm. The supernatant was removed using a micro-pipette. It was then allowed to dry (so as to remove any remaining ethanol), 50ul of TE was added and then re-suspended by vortexing. This was the plasmid that was then used for the restriction digestion which followed.

Plasmid DNA restriction digestion

To the plasmid DNA tubes (PBlueScript and plasmid 1, 2 and 3) 10ul plasmid DNA, 2ul 10X EcoRI buffer, 7ul sterile water, and 1ul EcoRI were added. The tubes were then incubated in 37oC water bath for 30minutes, after which 2ul of loading buffer was added to each digest. The tubes were then loaded on 1% agarose gel as follows;

Lane

Sample

1

1kb DNA ladder

2

pBlueScript digested with EcoRI

3

Plasmid 1 digested with EcoRI

4

Plasmid 2 digested with EcoRI

5

Plasmid 3 digested with EcoRI

Electrophoresis was carried out for 30 minutes at 100V and then visualised on gel documentation device.

RESULTS

Transformation Efficiency of the pBlueScript and test plasmid

Transformation efficiency = total amount of colonies on the Agar plate

Amount of DNA spread on the Agar plate

The amount of DNA spread on the Agar plate =

Total amount of DNA started with X fragment of DNA spread onto Agar plate

200 X 100 (ug) = 20000ug

pBlueScript : (100ul Plate):

the number of colonies = 18

transformation efficiency = 18 X 1000000

20000

= 900 colonies/ul = 9 X 102 colonies/ug

pBlueScript : (600ul Plate):

the number of colonies = 78

transformation efficiency = 78 X 1000000

20000

= 3900 colonies/ul = 3.9 X 103 colonies/ug

Test plasmid: (100ul Plate):

the number of colonies = 25

transformation efficiency = 25 X 1000000

20000

= 1250 colonies/ul = 1.25 X 103 colonies/ug

Test plasmid: (600ul Plate):

the number of colonies = 168

transformation efficiency = 168 X 1000000

20000

= 8400 colonies/ul = 8.4 X 103 colonies/ug

As regards the positions of the positions of the primers in the double - stranded sequence of the vector, here are their positions below;

1 cgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgc

gcgaccgttcacatcgccagtgcgacgcgcattggtggtgtgggcggcgcgaattacgcg

61 cgctacagggcgcgtccattcgccattcaggctgcgcaactgttgggaagggcgatcggt

gcgatgtcccgcgcaggtaagcggtaagtccgacgcgttgacaacccttcccgctagcca

121 gcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaag

cgcccggagaagcgataatgcggtcgaccgctttccccctacacgacgttccgctaattc

181 ttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattgta

aacccattgcggtcccaaaagggtcagtgctgcaacattttgctgccggtcacttaacat

241 atacgactcactatagggcgaattgggcccgacgtcgcatgctcccggccgccatggcgg

tatgctgagtgatatcccgcttaacccgggctgcagcgtacgagggccggcggtaccgcc

301 ccgcgggaattcgatatcactagtgaattcgcggccgcctgcaggtcgaccatatgggag

ggcgcccttaagctatagtgatcacttaagcgccggcggacgtccagctggtataccctc

361 agctcccaacgcgttggatgcatagcttgagtattctatagtgtcacctaaatagcttgg

tcgagggttgcgcaacctacgtatcgaactcataagatatcacagtggatttatcgaacc

421 cgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacaca

Gcattagtaccagtatcgacaaaggacacactttaacaataggcgagtgttaaggtgtgt

481 acatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactca

tgtatgctcggccttcgtatttcacatttcggaccccacggattactcactcgattgagt

541 cattaattgcgttgcctcactgcccgctttccagtcgggaaacctgtcgtgccagctgca

gtaattaacgcaacggagtgacgggcgaaaggtcagccctttggacagcacggtcgacgt

Sample loading point (wells)

For the PCR electrophoresis:

ve electrode

Lane(s) 1 2 3 4 5 6

+ ve electrode

Direction of DNA migration from negative electrode to positive

Figure 2. Gel visualisation on the gel documentation device for PCR fragments.

From the figure 2, it can be seen that there was contamination in both the negative control and in lane 4 due to the amplification in these lanes. These contaminations could have occurred due to human error.

For the Plasmid electrophoresis: figure 3 also indicates contamination in the lanes due to amplification and this can also be due to human error or mistakes in the loading of the gel.

Sample loading point (wells)

- ve electrode

Lane(s) 1 2 3 4 5

+ ve electrode

Direction of DNA migration from negative electrode to positive

Figure 3. Gel visualisation on the gel documentation device for the plasmids DNA after being cleaved by restriction enzyme.

DISCUSSION

The manipulation of DNA as been greatly influenced by the range of techniques which have been developed in the last 4 decades, these tools have enabled the analysis, manipulation and detection of DNA through biological processes.

Bacterial transformation is a technique that is constantly used in a molecular biological laboratory. It involves the introduction of a foreign plasmid into bacteria, which is then used to amplify the plasmid in order to generate large quantities of the plasmids (cloning).

Bacterial transformation can either be cell-based cloning via the use of plasmid vectors and host cells, or cell-free cloning i.e. Polymerase Chain Reaction (PCR). Both techniques are quiet unique both they have their benefits and limitations.

The PCR technique is quick and easily performed in a few hours compared to the cell-based cloning, which can take weeks. Although it requires time to design and synthesize the primers, this has been made easy by using computer software for the primer design.

PCR technique is also highly sensitive and can amplify sequences of small amount of target DNA (Li et al, 1988). However, the extreme sensitivity of this method points out that great care must be taken to avoid contamination of the sample under external DNA i.e. small amounts of cells from the promoter.

The major limitations of the PCR cloning is that in order to obtain specific oligonucleotide primers which then allows amplification, prior sequence information is needed, meaning that the DNA fragment of interest has to be characterised first by cell-based cloning. The size of PCR products (0.1- 5kb) is usually smaller compared to those of the cell-based cloning (2MB) and the products obtained are also limited unlike the cell-based cloning.

In the cell-based cloning, there is in vivo DNA replication which brings fidelity of copying due to proofreading but in the PCR cloning the DNA is replicated in vitro which then increases error.

The transformation efficiency calculated in this experiment was 9 X 102 colonies/ug for pBlueScript (100ul) plate and 3.9 X 103 colonies/ug for pBlueScript (600ul).

The transformation efficiency for the test plasmid were 1.25 X 103 colonies/ug and 8.4 X 103 colonies/ug for the 100ul and 600ul plates respectively.

However, these results indicate poor transformation efficiency because they are not above 104.

The identification of the inserted DNA using these two ways would have worked if only the errors involved were avoided. This was shown on the gels in the result indicating amplification at lanes that are meant to just have a band, indicating the plasmid without being cleaved yet.

CONCLUSION

Commercial plasmids serve as efficient vectors to clone foreign DNA and allow for cloning of genes across species barriers. Restriction enzymes recognize specific sequences which they cleave and selectable markers serve to identify bacterial cells that take up plasmids with foreign inserts. In this experiment both techniques used actually failed in that there was much error in the PCR cloning and less errors in the cell-based cloning. This may be to their transformation efficiencies which showed that the test Plasmids had a higher value of transformation efficiency.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.