Asthma Through Multi Target Network Regulation Biology Essay

Published:

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Qingfei Xiaoyan Wan is widely used for relieving cough, asthma, upper respiratory tract infection, bronchitis, pneumonia, and etc in clinic. This study established a histamine-induced asthma model in guinea pigs, administered with QFXY. Hematoxylin-Eosin staining sections were applied for the evaluation of QFXY effect. In both Model and QFXY group, customized microarrays and 2D electrophoresis were adopted to detect differentially expressed genes (diff genes) and proteins (diff proteins) respectively, and some diff proteins were identified with MALDI-TOF/MS. The checked diff genes and proteins underwent Cluster, GO and KEGG analysis. The relation network of all diff genes in asthma related gene pool from GAD and HPRD was achieved. The targets and pathways primarily revealed in this study contributed to the anti-asthma mechanism of QFXY. The detailed ingredients of QFXY may be candidate asthma controller.

Keywords: asthma, Traditional Chinese Medicine, microarray, 2D- electrophoresis, MS identification, multi-target network

Introduction

Asthma, as defined in 2008 by the Global Initiative for Asthma (GINA), is an inflammatory disorder of the airways in which many cells and cellular elements play a role [1]. Bronchial hyperactivity associates with inflammation, that together with an external or environmental insult, on a vulnerable bronchial epithelial structures, generates tissue remodeling and respiratory functional impairment [2]. Asthma is not a curable disease at the present time [3,4]. However, with proper treatments, the risk of mortality for asthmatic individuals could be comparable to that of the general population. Presently, the treatment of asthma includes a dual focus: the short-term treatment of acute symptoms with bronchodilators, and together with the prevention or eventual reversal of chronic inflammation using anti-inflammatory drugs [5].

Medications to treat asthma can be classified as controllers or relievers. Controllers are medications taken daily on a longterm basis to keep asthma under clinical control chiefly through their anti-inflammatory effects. Relievers are medications used on an as-needed basis, which act quickly to reverse bronchoconstriction and relieve its symptoms [6]. The major medications in asthma management includes bronchodilating β2-agonists,anti-inflammation inhaled corticosteroids, leukotriene modifiers and theophyllines. The use of rapid-actingβ2-agonists in long period may lead to relative refractoriness toβ2-agonists [7]. Long-acting inhaledβ2-agonists, including formoterol and salmeterol, should never be used as monotherapy for asthma as these medications do not appear to influence the airway inflammation in asthma. They are most effective when combined with inhaled glucocorticosteroids, and this combination therapy is the preferred treatment when a medium dose of inhaled glucocorticosteroid alone fails to achieve control of asthma [8,9]. Inhaled glucocorticosteroids are currently the most effective anti-inflammatory medications for the treatment of persistent asthma. The systemic side-effects of long-term treatment with high doses of inhaled glucocorticosteroids include easy bruising, adrenal suppression and decreased bone mineral density and etc. When the drugs are discontinued, deterioration comes out within weeks to months in proportion of cases [6]. Leukotriene modifiers are associated with dose reductions of inhaled glucocorticosteroids, while monitoring of liver tests is recommended during their treatment for the underlying liver toxicity [10]. Theophylline, a bronchodilator, when given in a lower dose, has modest anti-inflammatory properties, but needs proper monitoring for its narrow therapeutic range [11]. As mentioned above, there is a consistent need to explore noval effective anti-inflammtion and bronchodilator drugs, especially suitable for the senior and children or chronic patients.

QFXY is originated from a famous Traditional Chinese Medicine (TCM) formula "Maxing Shigan Decoction". It has been experimentally improved, consisting of eight materia medicas, Ephedra Herba, Saigae Tataricae Cornu, Pheretima, Arctii

Fructus, Lepidii Semen, Bovis Calculus Artifactus, Armeniacae Semen Amarum, and Gypsum Fibrosum. Since decades of extensive clinical practice, QFXY Pills has shown significantly therapeutic effects on dissolving phlegm as well as relieving cough, asthma, upper respiratory tract infection, bronchitis, pneumonia, and etc, but its underlying action mechanism still remains elusive [12].

Our previous study revealed QFXY composition with UPLC/Q-TOF-MS, consisting of 55 ingredients including 27 absorbable constituents [13]. In this study histamine-induced asthma model in guinea pigs were established, and QFXY was administered orally. HE stained sections were applied for QFXY effect evaluation. Customized microarrays and 2DE were adopted to detect differentially expressed genes and proteins ("diff genes" or "diff proteins" for short) respectively. Some diff proteins were identified with MALDI-TOF/MS. Cluster, GO and KEGG analyses enrich the functions and pathways of the diff genes and proteins. Based on asthma related genes from GAD and HPRD databases, the interaction network of all diff genes (including both diff genes from microarrays and diff genes blasted from diff proteins from 2DE) with asthma related genes was achieved, which indicated QFXY had multi-target regulation on asthma. Some detailed ingredients of QFXY may become candidate anti-asthma drugs in the future.

2. Results and discussion

2.1 Histopathological results

To test the QFXY effect, the pathological sections of lung tissues were stained by HE, demonstrated in Figure 1. In the Model group (Fig 1B), pathological sections showed significant edema of tracheal mucosa, presenting mucosa epithelial cells swelling, some epithelial cells in spongiform vacuoles degeneration, necrosis and loss, and more goblet cells. Narrowed or even blocked bronchial lumen, thickened smooth muscles of the bronchial walls, and mucous plugs were visible and bronchial vascular congestion and angiogenesis, and inflammatory cell infiltration in mucosa and submucosa as well as perivascular tissues. In the Normal group (Fig 1A), neither was obvious edema in airway mucosa, nor inflammatory cell infiltration in airway and vascular vessels. Bronchial tube cavity is smooth and unblocked. Comparing with the Model group, the QFXY group (Fig 1C) has obvious change in bronchial lung structure, more similar to the Normal group, which preliminarily showed sound effect.

Studies in animal models form the basis for our current understanding of the pathophysiology of asthma, and are central to the preclinical development of drug therapies [14]. Guinea pigs have been the most commonly used small animal species in preclinical studies related to asthma and COPD [15].β2-adenoceptor agonists and antimuscarinic drugs prevent antigen-induced bronchoconstriction in actively sensitized guinea pigs in a dose-dependent manner. Histamine is the major mediator in guinea pigs but not in humans [16].

Asthma is a complex disease defined by reversible airway narrowing, acute and chronic airway inflammation, airway hyperresponsiveness (AHR) and airway tissue remodeling, in which accumulation of airway smooth muscle (ASM) is a prominent and widely reported feature [17]. In the pharmacodynamics study, the prolonged asthma time [12] and HE sections showed that QFXY had significant effects on asthma, reducing edema in airway mucosa and inflammatory cell infiltration in airway and vascular vessels. They were also beneficial to reducing airway remodeling.

2.2 Microarray analysis and qPCR validation

In our study, we firstly customized guinea pig (Cavia porcellus) cDNA microarrays using the sequences as many as we could archive in NCBI (19911EST and 930CDS), which assemble can be used as a microarray design template for guinea pig.

SAM analysis screened 55 diff genes of guinea pig, with 14 up-regulated and 41 down-regulated, shown in Supplement 1. Hierarchical Cluster analysis generated a heat map, in which the vertical ordinates showed various chips, and the horizontal ordinates showed genes expressed in all chips. Heat map is a visual diagram, shown in Figure 2, generally revealing gene expression module comparison of the samples. As shown in the Heat Map of the Figure 2, 2_4 and 2_9, the expression profile of the QFXY group had more similarity to that of the Normal group, which suggested that with the QFXY treatment, the overall gene expression profiles were reduced to the normal level, indicating the mitigation and improvement of asthma. The gene expression of diff genes were verified with qPCR, seen in Fig 4A-4E. The correlation of expression level in microarray and qPCR seen in Fig 4F The qPCR change profile were basically in line with the microarray results, proving the reliability of microarray data.

There are few guinea pig research data of definite functions of genes and signal pathways. In NCBI, we blasted 55 diff genes of guinea pig and got 27 human homologues. It was reported that many genes were involved in inflammatory signal, airway smooth muscle cells, smooth muscle remodeling, and other functions related to the secretion of matrix proteins, especially MAPK3, RHO, VIM, CLU, GNB1, ENO1 (3) which are closely related to the asthma inflammation. The molecular function, biological process and cellular component of the 27 diff genes were seen in Supplement 3, especially involved in such biological processes as signal transduction (4), protein phosphorylation (3), stress response (3) and etc. The GO annotation suggested that QFXY pills might influence the signal transduction, stress response, the apoptosis of endothelial and bronchial cells.

The diff genes participate in some pathways, shown in Supplement 4. pathway analysis revealed that different genes were involved in the signaling pathways, including focal adhesion pathway, cell-extracellular matrix interactions pathway, TGF-beta signaling pathways, NK cell-mediated cytotoxic pathway and so on, which are all related with cell signaling, inflammation, mast cells and NK cells. Many asthma drugs also participated in those pathways in variety of mechanisms, targeting kinases, receptors or related proteins, affecting inflammation response, mitosis, angiogenesis, apoptosis, and anti-oxidation, to play a role in asthma.

2.3 2D-electrophoresis (2DE), MS identification and validation

2DE results were seen in Figure 3. Some diff proteins were identified using MALDI-TOF/MS seen in Table 2. Due to limited research data of guinea pig, diff proteins were blasted into human proteins as well as relevant genes. Protein expression was validated with qPCR and Western blot (Figure 5). The expression level of HSP90 decreased and Serpin increased with QFXY treatment.

2.4 The functions of diff genes and diff proteins

2.4.1 Anti-inflammation

The MAPK3/ERK signaling cascade is a central MAPK pathway that plays a role in the regulation of various cellular processes such as proliferation, differentiation, development, and inflammation reactions and etc [18-21]. Inhibition of this kinase strongly decreased the expression of pro-inflammatory genes encoding growth-regulated proteins (Gro-a, Gro-b and Gro-g) and interleukins (IL-1β, IL-6 and IL-8) [20]. MAPK can participate in the regulation of NF-κB transcriptional activity [22,23]. Our previous study also presented decreasing ERK expression and NF-κB inhibition [13].

HSP90, as a molecular chaperone, has interactions with proteins, such as Akt and Raf1 [24]. Akt is a downstream effector molecule of phosphoinositide 3-kinase and is thought to mediate many immune and inflammatory responses. It is also involved in the activation of NF-κB [25]. Amino acid residues 229-309 of Akt were involved in the binding to Hsp90 and amino acid residues 327-340 of Hsp90b were involved in the binding to Akt [26]. Hsp90 plays an important role in maintaining Akt kinase activity. In our study, 2D and Western blot showed decreased HSP90 after QFXY treatment, as well as less NF-κB activity [13], indicating QFXY may affect the binding of HSP90 and Akt, which needs further confirmation.

GTP-binding protein beta1 subunit gene (GNB1), its up-regulation appears to be one of the candidate processes of sensitization. It also has NF-κB recognition sites [27]. The Ectodysplasin is involved in binding to its ligand EDA-A1 and activates the NF-κB intracellular signaling pathway by interaction through its death domain with the adaptor protein EDARADD [28]. Down-regulated GNB1 and EDARADD gene expression decreased NF-κB activity for anti-inflammation.

2.4.2 Regulating lung tissues as well as anti-inflammation

Serpins form an enormous superfamily of 40-60-kDa proteins found in almost all types of organisms. Most have evolved to finely regulate complex proteolytic pathways, such as blood coagulation, fibrinolysis, and inflammation [29,30]. α1-Antitrypsin (AAT) is an archetype member of the serpin supergene family. The reduced serum levels of AAT contribute to the development of chronic obstructive pulmonary disease (COPD). In addition to protease inhibition, AAT shows anti-inflammatory, immunomodulatory and antimicrobial properties [31,32]. SerpinA1 is an endogenous anti-inflammatory factor, and its anti-inflammatory effects may be mediated through antioxidant activity [33]. Compared with the Model group, the HE sections of the QFXY group showed less inflammation and mucosa hyperplasia, and the 2D and qPCR proved higher Serpin expression, which indicating specific ingredients in QFXY can activate Serpin.

Asthma is a disease characterized by persistent inflammation and structural changes in the airways, referred to as airway remodeling., including smooth muscle hypertrophy, goblet cell hyperplasia, subepithelial fibrosis, and angiogenesis. Vascular remodeling in asthmatic lungs results from increased angiogenesis, mediated by vascular endothelial growth factor (VEGF). In addition, VEGF induces allergic inflammation, enhances allergic sensitization, and has a role in Th2 type inflammatory responses [34]. Matrix GLA protein (MGP) has a role in endothelial cell (EC) function [35]. MGP modulates the activity of transforming growth factor (TGF)-β superfamily, which is critical for morphogenesis and development [36]. MGP can stimulate VEGF expression through increased TGF-βactivity in endothelial cells [37]. Comparing with the Model group, HE sections in the QFXY group showed less pulmonary consolidation, which means QFXY help alleviate lung tissue remodeling.

Asthma is characterised by reversible airway obstruction. The lack of full reversibility in some asthmatic patients may be due to chronic airway remodeling [38]. It appears that inflammation and remodeling are interdependent processes that clearly influence the clinical long term evolution of asthma [39]. The ECM can act as a reservoir for an increasing number of growth factors. These growth factors can be rapidly released from the ECM to allow extracellular signaling regulated by the growth factors to proceed without the need for new protein synthesis [40].

2.4.3 Common pathways

Diff genes participated in several common signal pathways, some of which were involved in inflammation (Hs_EGFR1_NetPath_4, Hs_IL-2_NetPath_14, Hs_IL-6_NetPath_18, Hs_TNF-alpha-NF-κB_NetPath_9), cell movement and proliferation as well as airway remodeling of the cytoskeleton and extracellular matrix (Hs_Regulation_of_Actin_Cytoskeleton, extracellular matrix, intermediate filament cytoskeleton, structural constituent of cytoskeleton, actin binding, actin cytoskeleton), and airway smooth muscle contraction (Hs_Smooth_muscle_contraction, Hs_Striated_muscle_contraction), multi-level signaling protein folding (protein folding, unfolded protein binding), cell adhesion and signal transduction (Adherens junction, Focal adhesion), the endomembrane system (endomembrane system), gene regulation (Mechanism of Gene Regulation by Peroxisome Proliferators via PPARa (alpha)) and so on. Important genes involved include HSP90A1, SerpinA1, MAPK3, ACTG1, VIM, TNNT2, GNB1, CRYAA, CRYAB, COL4A2, COL1A2 and so on. The commonly shared signal pathways of diff genes and diff proteins combined the genomics and proteomics together, to manifest the underlying mechanism of QFXY effects.

2.5 Multi-target network based on interactions between all diff genes and asthma related genes

To further investigate relationship between asthma genes and the diff genes (and proteins) identified in our platform, we constructed a sub network containing 1214 nods and 1886 interactions, as an asthma disease network. In Figure 6A, red for known asthma genes (resourced from HRPD&GAD), green for diff genes (including those blasted from diff proteins), yellow for diff genes which had direct interactions with asthma genes, blue for other genes directly interacting with asthma genes. The Fig 6A contained 16 diff genes, 182 asthma genes (from databases), and 1016 genes directly interacting with asthma genes. The detailed Fig6B included 16 diff genes, 41 asthma genes (from databases), and 121 genes directly interacting with asthma genes.

HSP90α, MAPK3, VIM were hub proteins, suggesting that they may be some targets of QFXY pills. The complicated interaction network suggested that QFXY pills affected a complex system regulating inflammation and immune reactions.

Seen from the above complex network, QFXY interacts with asthma related genes in both direct and indirect way, affecting several signal pathways. In the previous study, 55 ingredients have been identified, including 27 absorbable constituents in QFXY, among which there are 19 ingredients affect inflammatory pathways, typically they aresulfur containing alkynes (No.11, 15, 18, 44, 45), such as Arctic acid; lignans (No.27, 48), such as Arctigenin; phenolic acids(No. 6, 14, 16, 31, 36, 38, 41), such as Sinapic acid; steroids (No. 25, 35, 37, 39), such as Cholic acid. [13]. In the following study, other effects of these ingredients, such as alleviating airway hyperresponsiveness (AHR) and airway tissue remodeling will be further explored.

In conclusion, a primarily combined genomic and proteomic screen of QFXY targets display a series of candidate genes and proteins, which

Qingfei Xiaoyan Wan

Ant-inflammaiton

Anti-remodeling

ERK

HSP90

GNB1

EDARADD

Serpin

MGP

Multi-target network

3. Experimental

3.1 Drugs and animals

QFXY (Lot. 100512) was provided by Tianjin Zhongxin Pharmaceutical Group. Guinea pigs of England specie, (200 ± 20) g, male and female, were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.

3.2 Protocol of asthma model

Inside an inverted cup, guinea pigs were given 0.1% histamine phosphate for 10 s with ultrasonic sprayer (0.5 mL/min). The time when asthma occurred was recorded. The asthmatic guinea pigs were randomized into 3 groups, QFXY1(397.5mg/100g BW) , QFXY2(132.5mg/100g BW) and Model group (n=6 for each group), were administrated orally with QFXY and normal saline respectively for 7 days. Again, guinea pigs were put into the glass cup and given 0.1% histamine phosphate for 10s, and prolonged period of asthma was recorded. Use GraphPad Prism 5.0 for ANOVA. There was another group without any treatment as the Normal group for the following pathological sections and microarrays. The lung tissues of guinea pigs prepared for further experiments.

3.3 Pathological analysis

Guinea pig bronchial and lung tissue HE sections were done according to the regular methods [41]. Briefly, the fresh lung tissue samples were fixed in 10% formalin, and embedded in paraffin. Samples were cross-cut into40-50 slices and the thickness of 4-5μm. The slices were stained by Hematoxylin-Eosin (HE). Finally, the stained sections were observed in light microscope(100Ã- and 40Ã-).

3.4 Microarray procedures and data analysis

Total RNA of each group was extracted with Trizol (Invitrogen, USA) and purified using Nucleo Spin RNA Clean-up Kit (MN, Germany). RNA concentration and integrity were determined by UV-1800 Spectrophotometer (Shimadzu, Japan) and agarose gel electrophoresis. 4 Guinea pigs gene expression chips were customized (Agilent Technologies, USA). The dual-channel chips were scanned with LuxScan 10KA dual channel laser scanner (CapitalBio, China). In the primary hybridization profiles, cy5 in red, cy3 in green, the relative differential ratio of signal strength, cy5/cy3, presented the varied gene expression. 3 chips were QFXY/ Model, 1 chip was Normal/ Model. RNA of the QFXY group was isolated from each sample individually and was not pooled. But RNA samples from the Model group and Normal group were pooled to reduce biological differences [42].

SAM (Significance Analysis of Microarrays) One Class method was adopted for the analysis of diff genes. Standard criteria for diff genes were |Score (d)| ≥2 and FoldChange≥2 (or ≤0.5). Cluster 3.0 was used with the hierarchical average linkage algorithm to get a heat map. In PubMed, the reference sequences of guinea pig were blasted to human genes, with the E value less than 1e-5, and the similarity between two sequences spanned over half sequence length. The human genes were imported Molecule Annotation System (MAS3.0) for GO and KEGG Pathway analysis.

3.5 2D-electrophoresis and MS identification

Total proteins were isolated from 20 mg lung tissues of each group, with protein concentration diluted to 2mg/ml by Bradford method. In 2D-electrophoresis instrument (BIO-RAD), pH 3-l0 precast IEF strips, 0.7mg sample loading, total v • h 80 000, 120g/L gel for SDS-PAGE, and Coomassie brilliant blue staining method was adopted.

The GS-800 scanner was used for acquiring image, with PDQuest 7.1 software for dot cutting, editing, detecting and matching. MS analysis providing purity, molecular weight, amino acid sequence, composition of peptide fragments, as well as the database support, differential proteins can be identified. Based on the MS report, protein score greater than 60 or single peptide score over 30 is more reliable. If more than one protein scored over 60, the top ranked is more credible. C.I. % over 95% is also reliable criteria. Besides, we also compared the theoretical protein molecular weight and isoelectric point with those we obtained in 2DE analysis. Further more, the diff proteins can be blasted into genes for further study.

3.6 Quantitative real-time PCR and data analysis

Validation of changes of diff genes in guinea pig lung tissues was carried out by real-time quantitative polymerase chain reaction (qPCR). First, total RNA was converted to cDNA using High Capacity cDNA Reverse Transcription Kits (ABI, USA). According to the reference sequences of guinea pig, the primers used are as follows: RHO (forward: 5'-CACCGCTCAACTACATCCTGC-3', Reverse: 5'- GCCCGAAGACGAAGTATCCA-3') , GNB1 (forward: 5'- TCCATCTACAATCTGAAGACTCGC -3', Reverse: 5'- TAGTCTGGTGTCGGGAGCG -3') , MAPK3 (forward: 5'- CTCAACCACATTCTGGGTATCC -3', Reverse: 5'- CCACCTTAGTCTTAGAGGGCAGA -3') , CLU (forward: 5'- GGATGAAGGACCAGTGCGAG -3', Reverse: 5'- CGTGGAGACATGGAGATAGGC -3') , ENO1 (forward: 5'- CAGAAGTCACAGCCAGCGTG -3', Reverse: 5'- CTTTGAGCAGCAGGCAGTTG -3'), HSP90α (forward: 5'- GGCAGAGGCTGATAAGAACG -3', Reverse: 5'- AGTCATCCCTCAGCCAGAGA -3'), SERPIN E2 (forward: 5'- CAGGGTCAGAAAACCTCCAT -3', Reverse: 5'- CTGCCCCATGAATAACACAG -3'), GAPDH (forward: 5'- GAACATCATCCCCGCATCC -3', Reverse: 5'- GTCCTCGGTGTAGCCCAAGA -3'). Real-time qPCR for quantitative assessment of mRNA expression was performed on LightCycler 2.0 (Roche, Swiss) with GoTaq qPCR Master Mix (Promega, USA) according to the manufacturer's protocol. The PCR conditions were as follows: 94 °C for 2 min, followed by 40 cycles of amplification (95 °C for 15 s, 55 °C for 30 s, 72 °C for 30 s), and a dissociation stage. 2-ΔΔCt method was applied for data analysis.

3.7 Western blot of HSP90

The protein sample (20 mg) was separated by 12% denaturing SDS-PAGE and blotted onto a nitrocellulose membrane. After electrophoresis, the proteins were transferred to nitrocellulose membrane by electrophoretic transfer system. The membranes were blocked in 5% skimmed milk in TBS for 1h, and then incubated with primary antibody (anti-HSP90 at 1:2000 dilution and anti-β-actin antibodies at 1:10000 dilution) overnight at 4℃. The membranes were incubated for 2 h in horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (1:2500 dilution) for 2 h. Antigen-antibody complex was visualized by enhanced chemiluminescence reagents Supersignal (Pierce, Rockford, IL). For quantification, Quantity One software (Bio Rad, USA) was used.

3.8 Multi-target network construction

Human protein interactions data were sourced from Human Protein Reference Database (HPRD, http://www.hprd.org/) as the background. Asthma related genes were from Genetic Association Database (GAD, http://geneticassociationdb.nih.gov/), which were annotated to the background network. Those nodes having direct interactions with asthma genes were used to build an asthma disease subnetwork. Keep the possibly same interactions in the subnetwork and HPRD network overlapped. We annotated the diff genes (from both microarray and 2DE data) in the asthma disease subnetwork and achieved the multi-target regulation subnetwork of QFXY.

3.8 Statistics

The significance in mean values was analyzed by ANOVA with least squares difference among groups. Values were considered statistically different at p<0.05.

Acknowledgements

This study was financially supported by grants from the National Nature Science Fund (NNSF) of China (No. 81173638).

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.