Aspergillus flavus impairs antioxidative enzymes of Sternochetus mangiferae during mycosis

Published:

Aspergillus flavus impairs antioxidative enzymes of Sternochetus mangiferae during mycosis

Abstract

Insects depend upon cuticular, humoral and cellular defenses to resist mycosis, however, entomopathogenic fungi, through co-evolution, have developed mechanisms to counter the host’s defenses. They deploy a combination of assaults to breach cuticular defense and access the nutritious hemocoel. During colonization, entomopathogenic fungi produce a plethora of metabolites to suppress the host’s immune system. Although different mechanisms of pathogenicity by entomopathogenic fungi are investigated, studies on the impairment of insects’ antioxidative enzymes remain elusive. Here, we used the interaction of Sternochetus mangiferae and its associated entomopathogenic fungus, Aspergillus flavus, as a model to validate our hypothesis. Uninfected insects were exposed to fungal spores for infection to occur. We observed symptoms of mycosis within 48 h and mortality after 120 h of incubation period. Biochemical studies on the antioxidative enzymes, namely catalase, peroxidase and polyphenoloxidase, in infected and uninfected insects revealed impairment of these crucial enzymes. It appears that A. flavus disables the host’s antioxidative enzyme system that plays a crucial role in elimination of oxidative toxins produced during mycosis.

Lady using a tablet
Lady using a tablet

Professional

Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

Keywords: Aspergillus flavus, Sternochetus mangiferae, entomopathogenic fungi, saprophyte


1. Introduction

Insects being the most abundant and diverse organisms have attracted a variety of pathogens including viruses, bacteria and fungi. However, insect disease caused by fungi and their impact on insect populations is of agricultural interest worldwide (1-3 PNAS). The slow development of infection and inconsistent results of biological control compared to chemicals has deterred their use and improvement. An understanding of the fungal mechanism of mycosis is crucial to identify fungal virulence factors that could be manipulated to accelerate mycosis and host death so as to be in par with chemicals.

Entomopathogenic fungi (Hajek and Ledger, 1994) have evolved to counter the host’s defense system (11 PLoS One) by different mechanisms that are well studied (14, 15, 16 PLOS ONE). To cause infection, the fungus has to avoid, subvert or circumvent crucial defense systems. Given the response of plant defense against fungal infection by producing antioxidative enzymes, it is speculated that pathogens may impair these enzymes to avoid being killed. However, studies on the impairment of antioxidative enzymes of insects during mycosis are ambiguous. Among entomopathogenic fungi, genus Aspergillus is a complex group of anamorphic species (Rodriques et al., 1997). Although previous studies have recorded Aspergillus species infecting a wide range of insects (Ohtomo et al., 1975; Lillehoj et al., 1975; Widstrom et al., 1975; Fennel et al., 1977; Beti et al., 1995), they were not considered to be entomopathogens until recently (reference).

The mango stone weevil, Sternochetus mangiferae, is a devastating pest of horticultural importance. The control of this pest is fraught with difficulties and limitations due to diminutive knowledge about their ethology (Verghese et al., 2003). During collection of S. mangiferae (Kamala Jayanthi et al. 2012), we noticed fungal infection in a significant population of insects. Using morphological and molecular techniques, the fungus was identified as Aspergillus flavus. As A. flavus is a well-studied saprophyte, it was unclear if the fungus caused the mortality of these insects. In this study, we report the pathogenicity of A. flavus to S. mangiferae and counter mechanism the fungus uses to colonize its host, S. mangiferae.

2. Material and methods

2.1. Insects

S. mangiferae adults were collected from mango stones in the month of July 2012 at Indian Institute of Horticultural Research, Hesseraghatta, India according to the method devised by Kamala Jayanthi et al. (2012). The collected adults (n = 2500) were maintained in a rearing cage of dimension 30x30x30 cm in sterile laboratory conditions (27±1°C, 75±2% RH and 14h light and 10h dark photoperiod). The adults were provided with fresh mango leaves and water socked in cotton pad ad labium.

2.2. Isolation and characterization of A. flavus

During collection of mango stone weevils, fungal infection was observed to be the main cause of mortality (~70%) in the collected population. Initially, a white mycelial growth was observed on infected weevils followed by sporulation after 120 h. The primary culture of fungus was isolated by placing an infected stone weevil into a centrifuge tube containing sterilized saline (1 ml) and vortexed at low speeds to dislodge the fungal spores followed by serial dilution. The diluent containing the spores were inoculated on potato dextrose agar (PDA) plates using standard culture techniques. The cultures were allowed to sporulate for 120 h and were maintained at 4°C until further use (Mythili et al., 2010). For molecular characterization, the fungal isolate was cultured in 100 ml of sterile potato dextrose broth at 27°C for 96 h. The mycelial mass was separated by filtration and was freeze dried. DNA was extracted as described by Melo et al. (2006) and was quantified using standard spectrophotometric method. PCR (Polymerase Chain Reaction) reactions were performed using ITS 1 forward (TCCGTAGGTGAACCTGCGG) and ITS 4 reverse (TCCTCCGCTTATTGATATGC) primers and the amplifications were carried out in 25µl reaction mixture containing 2.5µl of 10x PCR buffer, 1µl of 25mM MgCl2, 1µl of 10mM dNTPs, 0.5µl of each primer (0.7µM), 0.3µl (3 U) of Taq polymerase (Pure Gene, India) and 1µl (50ng) of DNA template. Eppendorf gradient thermal cycler was used with the following PCR setting: an initial denaturation for 5 min at 95°C, 35 thermal cycles of denaturation for 1 min at 95°C, annealing for 1 min at 50°C followed by extension for 1 min at 72°C and a final 8 min extension at 72°C. Before sequencing the amplified PCR product was purified using PCR purification kit (Bioserve, India). The sequence was submitted to GenBank through Bankit (Accession number: grp3953651).

Lady using a tablet
Lady using a tablet

Comprehensive

Writing Services

Lady Using Tablet

Plagiarism-free
Always on Time

Marked to Standard

Order Now

2.3. Fungal Infection

For bioassays, conidia were harvested into sterile saline to a final concentration of 6.8 x 107 conidia/ml. The efficacy of the entomopathogen was determined by exposing insects to the saline containing the pathogen in a petridish for either 10 min, 30 min, 60 min and 120 min. Control weevils were treated with petridish containing sterile distilled water. Each treatment contained 150 weevils. Treated weevils were placed in sterile containers and were observed for 10 days. Dead weevils were removed; surface sterilized by dipping them in 1% Sodium hydrochloride solution for 5 min and subsequently washed with distilled water. The processed weevils were placed on sterile PDA plates for confirmation of infection. This experiment was conducted in triplicates.

Enzyme extraction

Tissues of both control and infected (48 h after infection) weevils were dissected and homogenized in 50 mM Tris-HCl buffer, pH 7.0 containing 1mM PMSF. The homogenate was centrifuged at 4ºC for 10 min at 10,000g and the supernatant collected was used as enzyme source. The crude enzymes were stored at -80ºC until further use. Protein concentration of crude enzyme extract was determined by the method of Lowry et al (1951) using bovine serum albumin as a standard.

Antioxidative enzyme assays of infected and uninfected weevils

Catalase activity

A reaction mixture comprising 50mM PBS (pH 7.0), enzyme extract and 10mM hydrogen peroxide was prepared and incubated at 28ºC for 10 mins. Boiled samples with no catalase served as control. The decrease in absorbance was measured and recorded at 240nm spectrophotometer over a period of 3 mins. One unit of catalase activity was expressed as the amount of enzyme capable of catalyzing the degradation of one micromole of hydrogen peroxide reduced per minute per milligram of protein, using an extinction coefficient of 39.4 mM-1 cm-1 (Aebi, 1984). Each assay was run in triplicates.

Peroxidase activity

Peroxide activity was assayed spectrophotometrically at 470 nm using catechol as a phenolic substrate with hydrogen peroxide (Díaz et al., 2001). The reaction mixture contained 0.15 ml of 4% (v/v) guaiacol, 0.15 ml of 1% (v/v) H2O2, 2.66 ml of 0.1M phosphate buffer (pH 7.0) and 40 µl of the enzyme extract. The same mixture solution without the enzyme extract served as control. All assays were run in triplicates.

Polyphenol oxidase activity

Polyphenoloxidase activity was measured as described Jiang et al (2003) but with minor modification. The reaction mixture consisted of 50 mM sodium phosphate buffer (pH 7.0), 2 mM dopamine to which 100 µl of enzyme extract was added. The rate of increase in absorbance at 472nm was recorded using a spectrophotometer. One unit of PPO activity is defined as the amount of enzyme that increases the absorbance of 0.01 units per min at 472nm. Reaction mixture without the enzyme served as blank.

Native PAGE and activity staining

Equal amount of protein from both infected and uninfected (control) weevils were subjected to native PAGE using 8% polyacrylamide gel (Davis 1964) under non-denaturing and non-reducing conditions. For activity staining and visualization of gels, methods described previously for catalase (Woodbury et al 1971), peroxidase (Lin et al., 2002) and polyphenol oxidase (Rescigno et al., 1997) were followed.

Data Analyses

Mortality (%) of weevils dipped into saline containing pathogens for varying time intervals was angular transformed and subjected to Analysis of Variance (ANOVA). Probit analysis was used to determine the LT50 values.

Results and Discussion

Insects have developed a formidable array of defenses against pathogens that are ubiquitous in the eco-system they inhabit. These extend from highly specialized cuticle to other specialized defenses. However, pathogens also have co-evolved with their hosts to counter these defenses. Although knowledge about different counter mechanisms of fungi to overcome their hosts’ defenses is studied, investigation on the impairment of antioxidative enzymes by entomopathogenic fungi remains elusive.

The molecular identification using the primers ITS 1 and 4 through PCR successfully amplified a product of ~650bp from the genomic DNA isolated from the isolated fungus (Fig.1). The sequence of the amplified product was subjected to nucleotide BLAST. From the results, the amplified PCR product showed 99% similarity to A. flavus. This sequence was submitted to NCBI and was given a GenBank accession number: grp3953651.

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

A. flavus is an effective fungal pathogen infecting a wide range of insects, but, its use in biological control is hindered because it produces aflatoxin, a carcinogenic secondary metabolite (Klich et al., 2007). Previous studies on the pathogenicity of A. flavus to a variety of insects are already reported (Glare et al., 2002; Kostantopoulou and Mazomenos, 2005). The present study established the pathogenicity of A. flavus to mango stone weevil. The exposed weevils showed symptoms of mycosis within 48h of treatment. They became inactive, stopped feeding, defecated watery excreta and failed to aggregate with healthy weevils. There was significant variation (F = 171.64; P < 0.0001; df = 140) in mortality of weevil that were exposed to A. flavus spores at 10 min, 30 min, 60 min and 120 min (Table 1). Probit analysis determined LT50 (Lethal Time) to be 24.9 ± 8.5 min (slope = 4.18 ± 0.14, P = 0.48). A. flavus was effective in establishing infection at a low exposure time (Table 3) and killed 90% of the exposed weevils. This confirmed that A. flavus was highly pathogenic to mango stone weevils.

Native PAGE gel activity staining for catalase, peroxidase and polyphenol oxidase revealed that uninfected mango stone weevils produced 2 isoforms of catalase, a peroxidase and a polyphenol oxidase. However, activity staining for the above enzymes from infested weevils (48 h incubated weevils) revealed that one of the isoform of catalase, peroxidase and polyphenol oxidase was inhibited. Catalase activity was reduced by 73% in tissues of infected weevils compared to tissues of uninfected weevils. Similarly, peroxidase activity was reduced by 82% and polyphenol oxidase activity by 91%. These results indicate that A. flavus may be targeting these enzyme systems. In insect-fungal pathogenesis, antioxidant enzymes systems play an important role in elimination of ROS (Zhoa et al., 2013; Rahimizadeh etal., 2007; Li etal., 2005). Decreased activity of these enzyme systems decreases the defense mechanism in insects (Lebeda et al., 1999). Dowd (1999) reported the relative inhibition of polyphenol oxidase by cyclic metabolites of Aspergillus and Penicillium species in Spodoptera frugiperda. In case of gall forming aphids, activity of peroxidase and chitinase were impaired (Inbari et al., 2003) by mycosis. Therefore, in the present study, the reduced activity of catalase, peroxidase and polyphenol oxidase (Fig. 3) suggests that A. flavus impairs these antioxidative enzymes, thus, making the weevil susceptible to mycosis.

Previous studies have established A. flavus as an effective entomopathogen to many insects. (Sahayaraj et al. 2012; Gopalakrishnan, 2005; Selvaraj et al., 2002). Two strains of A. flavus (VGCN9E and VGC2P) were found effective against larvae of the mosquito, Aedes fluviatilis (Batra et al. 1973; Schlein et al. 1985). But, the use of A. flavus in controlling insects is restricted by its notoriety of producing a deadly secondary metabolite, aflatoxin. This toxin is known to be carcinogenic to animals and humans alike. However, there are studies about isolation of A. flavus strains that do not produce aflatoxin at all (Cotty et al. 1994b) and were used successfully as a biocontrol agent (Dorner, 2004; Antilla and Cotty, 2002). Similarly, entomopathogenic A. flavus strains that do not produce aflatoxins can be identified for use in controlling insect population.

Conclusion

Oxidative stress is caused by accumulation of free radicals such as reactive oxygen species (ROS). Small quantities of ROS are formed even under normal conditions as byproducts of aerobic respiration (Pietta, 2000). However, the production of ROS increases when an organism is subjected to irradiation, chemicals, metal ions or infection (Knopowski et al. 2002). Overproduction of ROS may damage the cell membrane, DNA and may cause enzymatic inactivity (Martin et al. 1996; Berlett and Standtman 1997; Fnkel and Halbroook, 2000). To defend damages caused by ROS, insects produce many antioxidative enzymes. Surprisingly, meager attention has been directed towards insect in this regard. It is known that these enzymes can detoxify ROS upto a certain level beyond which the ROS induced damage may lead to the insect’s mortality. In this study, we show that the isolated strain of A. flavus impairs antioxidative enzymes thereby impairing detoxification. This impairment in detoxification may have led to the successful establishment of infection by A. flavus on the mango stone weevil, Sternochetus mangiferae.