Adherence Of Enterobacteriaceae To Surfaces Biology Essay

Published:

An increased awareness and a better understanding of the food industry and its associated risks with microbiological contaminations have been the result of the wide use of food safety management systems in Ireland. Hazard Analysis Critical Control Point (HACCP) is the main food safety system used throughout food industries. Although this system was introduced in the 1960's it was only in 1998 that the EU Hygiene of foodstuffs Regulations implemented this referential in all food businesses in Europe (Food Market Exchange 2001). Microbiological controls are performed to ensure the quality and safety of the food products. The progression in science and microbial technology have given a better understanding of food production, processing and preservation and the link between the microscopic and macroscopic world. This relation enables microorganisms to be thoroughly examined and evaluated. Food borne illnesses are the most widespread public health problems, creating social and economic burdens along with human suffering. In order to try reducing the risk of such illnesses and food intoxications, hygiene measures are required in food processing environments (Microbiological risk assessment 2006). The presence of Enterobacteriaceae in food or food-contact surfaces in such environments serves as hygiene indicators.

Lady using a tablet
Lady using a tablet

Professional

Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

Enterobacteriaceae are a large family of bacteria that comprise of at least 34 genera, 149 species and 21 subspecies. Cells are typically 0.3-1.8µm in length. (Blackburn date?) They are rod shaped, Gram negative facultative anaerobes and are natural inhabitants of intestines in both humans and animals. They are found extensively throughout the soil, water, on fruit, vegetables and cereals. They play a considerable role in human health as many pathogens fall under this family which are known to cause many infectious diseases. According to Kang et al (2007) a minute amount of 10 colony forming units (CFU's) of particular microorganisms can lead to life threatening infections especially in the immune-compromised. Salmonella typhimurium is responsible for typhoid disease while Escherichia coli is a common cause of gastroenteritis. (Becker et al 2008). Other Enterobacteriaceae associated diseases include hospital acquired pneumonia, bloodstream infections such as bacteraemia and septicaemia, urinary tract infections and intra abdominal infections (Denton 2007). Enterobacteriaceae have been predominantly associated with food pathogen outbreaks. As discussed by Reilly et al (1988) 224 outbreaks of salmonellosis associated with poultry meat were reported in Scotland alone between 1980 and 1985. Among the 2245 people infected 12 died. Salmonella typhimurium and Salmonella enteritis were the main serotypes associated with the outbreak. In recent years the serotype Enterobacter sakazakii now known as Cronobacter sakazakii been identified as an emerging pathogen. It has been found in infant milk formula and has been the cause of neonatal meningitis and sepsis. It targets immune-compromised infants and those with a low birth weight. (Van Acker et al 2000)

In the 1920's coli-aerogenes (coliform) group was essential as an indicator in the validation of adequate processing procedures in the dairy industry i.e. Pasteurization of dairy products. It is evident that since the 1950's the entire Enterobacteriaceae family has been preferred over other taxons as marker organisms as they are known to be better defined when it comes to their determination and the family includes more organisms of significance than other families. In the 1980's Escherichia coli was first used as a reference organism in the monitoring of drinking water supplies. (Mossel and Stryijk 1995) A microbial indicator according to Moore and Griffith (2000) is a micro-organism that is an indicator for the possible presence of pathogens.

1.2 Adherence of Enterobacteriaceae to surfaces.

The adhesion of microorganisms to surfaces in the food industry principally on processing equipment is one of the major concerns in the adequate control of quality and safety of food products. If cleaning and sanitation are insufficient, microorganisms on the surface can survive by the development of a biofilm. (Ortega et al 2009). A biofilm reduces susceptibility to disinfectant and increases polysaccharide production. The occurrence of a biofilm can lead to post processing contamination leading to a lowered shelf life of a product and the transmission of diseases. In addition it has been known to cause mechanical blockage, impairment of heat transfer, increase in fluid frictional resistance and the corrosion of metal. (Fuster-Valls et al 2007)

To date no ideal method for determining the cleanliness of surfaces has been available. The combination of visual, non microbial and microbiological methods can lead to an integrated cleaning monitoring strategy. (Griffith et al 1997). The ability to quantify microorganisms on food contact surfaces provides essential information for modelling consumer exposure from cross contamination in the food industry through food production, food transport and in food service environments. Many pathogenic bacteria have been known to adhere to surfaces especially stainless steel, glass and rubber. Stainless steel is used extensively throughout the food processing and the food transport industry. As described by Ortega et al (2009), stainless steel is most widely employed due to its 'mechanical strength, corrosion resistance and ease of fabrication'. Despite appearing smooth to the unaided eye, when stainless steel is viewed under the microscope it is shown to be very rough with many distinct flaws. These flaws are thought to harbour bacterial cells which with the addition of water and nutrients would enhance the microorganism's survival (Moore and Griffith 2002). There have been limited studies on the adhesion behaviour on Escherichia coli on stainless steel. Ortega et al (2009) stated 108cfu/ml of culture on stainless steel for 2 h at 20°C was under the detection limit. In contrast another study suggested 105cfu/cm2 were found on stainless steel after coupons were inoculated with 108cfu/ml at 4 °C for 24 h.

1.3 Sampling of surfaces with swabs and sponges.

Lady using a tablet
Lady using a tablet

Comprehensive

Writing Services

Lady Using Tablet

Plagiarism-free
Always on Time

Marked to Standard

Order Now

According to Hall and Hartnett (1964), a simple convenient sample procedure would be useful to 'trace route of infection', for the 'identification of human carriers, evaluation of decontamination procedures and bacteriological surveillance of the environment' which could therefore lead to 'in-service training of personnel concerned with sanitation'.

Surface sampling is becoming increasingly important and numerous investigations have been underway to find a simple, reliable, bacteriological test to determine, quantitatively, the sanitary quality of environmental, food and hand-contact surfaces. (Angelotti et al 1958). Cleaning schedules in the food industry are designed primarily to reduce both food debris and to diminish micro-organisms to levels that pose little or low risk to both safety and the quality of the product. (Moore and Griffith 2002)

Traditional swabs are made from a wooden or plastic shaft with cotton, rayon, dacron, or alginate fibres which are spun forming a bud at one end. Moore and Griffith (2007) discuss how the wetting agents applied to swabs have dramatic effects on the amount of bacteria recovered from a surface. The main points to be assessed in determining how effective particular swab types are depend on 'the removal of bacterial contaminants from a surface, the release of these bacteria from the swab bud and the subsequent cultivation'. It was found that cotton swabs absorbed more liquid than other swabs evaluated. When bacteria were recovered from wet surfaces it was evident that brush textured, Rayon and Dacron tipped swabs removed a significantly fewer CFU's compared to the cotton swabs. It was shown how cotton swabs performed equally as well when sampling a dry surface.

Moore and Griffith (2007) state that cotton swabs consist of a secondary wall that is made up of cellulose. This enables the cotton to swell when positioned in wetness to result in an increased absorption of liquid together with bacteria entrapped inside. These positive characteristics that enable cotton swabs to remove high levels of bacteria from a surface are thought to hinder the swabs release of the bacteria. It can be predicted that the use of a swab with a poor initial absorbency could subsequently result in a higher overall bacterial recovery with the aid of diluents to facilitate bacterial release. Moore and Griffith (2007) also discuss how it was evident upon leaving the swabs at room temperature for 24 h that the release of bacteria from the cotton swab was greater than other swabs. It was evident that the bacteria became entrapped within the cotton fibres therefore protecting the bacteria and helping to create a microenvironment enabling the bacteria to survive.

In contrast to Moore and Griffith (2007) statements, Copan Italia (2010) shows how open cell foam swabs have good release of the bacteria but demonstrated absorption of 3-5 times less than in traditional fibre swabs due to their structure (Figure 1). The development of Flocked swabs which have good releasing properties and can absorb five times more than cell foam swabs are widely used in clinical diagnostics but haven't been applied yet to the recovery of Enterobacteriaceae throughout the food industry.

Figure 1: represents the structure of different swab types. (Copan Italia 2010) A: Fibre wrapped swab in which sample diffuses and becomes trapped in fibre matrices e.g. cotton swab. B: Foam swab with hydrophobic open cells limit the amount of sample collected but it stays on surface for easy elution. C: Flocked swab in which a large volume of liquid sample stays close to the surface and elutes out spontaneously and rapidly.

1.4 Biochemical tests for the detection and quantification of Enterobacteriaceae and their limitations.

Current biochemical and culture based assays tend to be inexpensive and relatively simple however there are limitations with such tests. One of the main limitations includes the length of time that is needed for the detection and enumeration of bacteria. False- positive results, the loss of viability of bacteria from collection to its enumeration and the lack of growth of viable yet non cultural bacteria have been associated with current biochemical and culture based assays. (Rosrak and Colwell 1987)

Today the Gram stain procedure is of common use in laboratories as the first method of identification for a microorganism. The method was originally published in 1883 by Hans Christian Gram. This technique however isn't always demonstrative of true Gram nature. Some Gram positive bacteria may stain Gram negative due to cell wall damage in the bacteria by over exposure to oxygen. (Bahrani - Mougeot et al 2008)

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

Blackburn (date?) stated that the testing for enteric pathogens such as Salmonella requires specific methods that are labour intensive and can take several days to complete. Furthermore, pathogenic bacteria in food are often not homogeneously distributed and are present in low numbers making detection difficult. Many food production sites mainly prefer to test for enteric pathogens in external laboratories while the testing of E.coli and Enterobacteriaceae are routinely tested to provide convenient assessment of potential faecal contamination. Many methods published from International Organisation for Standardisation (ISO) methods are available, where many procedures of detection are quantitative. The majority of food manufacturers impose acceptable limits for a given microorganism. The Most Probable Number (MPN) technique from ISO 4831:2006 (ISO 2010) and plating using pour or spread technique are mainly used.

Violet Red Bile Glucose Agar (VRBGA) and Violet Red Bile Agar (VRBA) containing lactose have been deemed the most popular media for examining foods for Enterobacteriaceae. Their detection and enumeration are based primarily on their ability to produce acid and gas from the fermentation of glucose and lactose which is detected by the pH indicator neutral red. An overlay is recommended to ensure fermentation of the carbohydrates and to reduce the risk of oxidation as well as improving the specificity of these media and subsequently reducing interference from background flora or motile strains (Blackburn date?). There has been evidence that non Enterobacteriaceae bacteria can grow on VRBA and VRBGA therefore suggesting that this method can hinder specificity. The growth of Aeromonas spp has been detected on VRBGA according to Petzel and Hartman (1985) and VRBGA has been seen to be insufficiently selective indicating 52.4% of results obtained to be false- positive (Wook Oh and Kang 2004)

MPN methods can provide greater sensitivity compared with plating techniques when the contamination levels are low. However if the concentration of contamination is high the results show greater variation and may lead to false positive results. MPN technique consists of multiple tubes of different media including Buffer Peptone water, Enterobacteriaceae enrichment broth.(See figure 2) Enterobacteriaceae are oxidase negative and this test is used to test for the presence of the enzyme cytochrome oxidase to confirm presumptive colonies in correlation with glucose agar test which tests for fermentation of glucose. If fermentation occurs it results in abundant production of acid end products resulting in a colour change. This method required by ISO described by Rose et al (1974) has low precision and excessive time is necessary for analysis ranging from 5-7 days.

Figure 2: Most Probable Number (MPN) technique by ISO method.

API™ identification systems from Biomerieux are used widely throughout laboratories. ID32E, is a standardised system in which the identification of Enterobacteriaceae and other non fastidious Gram negative bacteria can be rapidly identified. Many studies have been reported using API as method of identification including those of Drudy et al (2006) and Galani et al (2007). The API/ID32E detection kit is the most extensive of the range of API products available. It includes 15 identification systems covering all groups of bacteria encountered in industrial microbiological laboratories (BioMerieux, 2010). The reliability of API™ identification systems it used throughout industries. Janda et al (2001) stated however that the tests included in the API 20E strip in 1975 were still the same in 2001 even if the numbers of taxons in the Enterobacteriaceae family has increased substantially between those years.

The ready to use Petrifilm system has been released by 3M healthcare for the detection of foodborne pathogens. It's easy to use technique comprises a selective media under a transparent film (3M healthcare). The media is hydrated by the addition of bacterial suspension and after incubation visible colonies can be counted. (Blackburn??) Despite this method being quick and convenient, Petrifilm systems are expensive. Limitations of this technique discussed by Mueller et al (2009) show that some colonies shown on Petrifilm are too small to see from naked eye. Therefore the use of magnification for accurate visualisation is required. It was shown that some organisms can liquefy the gel on the film allowing spreading of growth and subsequent damage to other existing colonies providing a lower count of colonies.

Standard methods such as conventional culture and biochemical based assays used to enumerate require 18-24 h for results to be obtained. Advances in modern molecular biology have seen the development of molecular assays such as the polymerase chain reaction (PCR) that have become extremely reliable and significant in the detection of bacterial species (Khan et al 2007).

1.5 Alternative DNA- based method for the detection and quantification of Enterobacteriaceae

1.51 DNA extraction

The principles of DNA extraction as discussed by Jordan (2008) include the degradation of microbial cell wall to release the DNA and to sufficiently remove sample components which can reduce assay efficiency and degrade the DNA. Due to the complexity of foods matrices there are many inhibitors of DNA extraction including carbohydrates, fats, proteins, metal ions, phenolics and cell debris.

1.52 Polymerase Chain Reaction

Polymerase Chain Reaction (PCR) is one of the most widely used molecular biology techniques in the laboratory. This is due to its specificity, flexibility, remarkable speed and its resilience (Mc Pherson et al 1995). PCR was developed in the 1980's and the technique has been continuously 'improved and modified to expand its versatility and applicability'. This DNA based method has become an essential and daily performed experimental technique in many research fields and clinical laboratories to detect pathogenic agents, to amplify genetic materials from limited volumes of DNA sample (µl) and for cloning for detection of genetic expression levels. (Yang et al 2005). PCR is useful for both the diagnosis and management of a variety of infectious diseases. (Louis et al., 2000)

PCR Mix:

PCR mix is made up of DNA polymerase, a forward and a reverse primer, nucleotides, a DNA Target and PCR buffer with MgCl2.

PCR steps

PCR amplification can turn a few molecules of a specific target nucleic acid into a microgram of DNA. Roche PCR Applications Manual (2006) explained how the process of PCR occurs in three main steps of 1) Denaturation, 2) Annealing and 3) Extension with the use of temperature cycling (figure 3). Denaturation occurs at 90°C when heat separates double stranded DNA into two single strands. Since the hydrogen bonds linking the bases to one another are weak they break at such high temperatures, whereas the bonds between the deoxyribose and phosphates which are strong covalent bonds remain intact. The goal of PCR process is not to replicate the entire strand of DNA but to replicate a target sequence of approximately 100-35,000 base pairs that is unique to the organism.

Primers are used to define the ends of that sequence. Primers are short, synthetic sequences of single- stranded DNA typically consisting of 20-30 bases. The annealing step takes place between 40°C to 65°C depending on the length on the length and sequence of the primers. This allows the primers to anneal specifically to the target sequence. Once the primers anneal to the complementary DNA sequences, the temperature is raised to approximately 72°C and DNA polymerase begins to synthesize new double stranded DNA molecules that are identical to the original target DNA. It does this by facilitating the binding and joining of complementary nucleotides that are free in solution (dNTPs). Synthesis always begins at the 3' end of the primer and proceeds exclusively in the 5' to 3' direction. The new synthesis effectively extends the primers, creating a complementary double stranded molecule from a single-stranded template.

Figure 3: Temperature Cycling in PCR (Kubiska 2006)

After the PCR process is complete, electrophoresis must be completed in order to

For the detection of bacteria within foods the mechanism of PCR has proved to be very effective. Low levels of 3cells of Campylobacter were found in meat samples using this technique (Waage et al 1999). However

During PCR amplification, short DNA sequences are copied at each cycle. Theoretically the amount of DNA at each cycle should double at each cycle, resulting in an exponential amplification of the initial target DNA. Fraga et al (2009) show how this is potentially true during the early stages of the reaction when the components present in PCR are in vast excess compared to the target sequence. As the product accumulates, the substrates become depleted resulting in inhibition. In order to look at the efficiency of the reaction, PCR can be divided into three distinct phases: exponential, linear and plateau. The first phase is exponential phase in which the reaction is 100% efficient with the doubling of product at each cycle. As the amplicon exponentially accumulates in quantity the PCR components are used up and the primers begin to compete with the amplicon and the reaction efficiency subsequently decreases. As the reaction slows down the linear phase begins. The product formed in this phase is highly variable due to the rate at which particular components are depleted and the accumulation of products. The plateau phase is when the reaction stops due to depletion of substrates and the inhibition of products. There is an extremely large difference between the linear phase and the final amount of product produced. In conventional PCR, detection of PCR product is completed late in the linear phase or at plateau phase. As seen in figure 5 there can be a distinct difference in the two phases showing that conventional PCR is variable when it comes to quantitative results.

Figure 5:

Limitations of conventional PCR as discussed by Fellon (2006) include poor reproductivity and poor precision. There is a high risk of contamination from the environment as the reaction tubes are constantly exposed to the air. A main disadvantage includes the requirement of the post PCR technique by the process of electrophoresis which can be inaccurate and time consuming. This technique with the use of agarose gel is based on size discrimination which may not be very precise due the amount of sample in plateau phase varying considerable.

EXAMPLES???

1.42 Real time PCR

The development of real time quantitative PCR (QPCR) presents more rapid, specific and quantitative enumeration of particular target genes as they are amplified in real time. In real time PCR the amount of product formed is monitored during the course of the reaction by monitoring the fluorescence of dyes or probes introduced into the reaction that is proportional to the amount of product formed, and the number of amplification cycles required to obtain a particular amount of DNA molecules is registered. (Kubista et al 2006). Real time PCR assays are characterized by a wide range of quantification of 7-8 logarithmic decades, high technical sensitivity, high precision and it doesn't require any post PCR steps therefore the risk of contamination is reduced. (Klein D 2002)

Real time PCR procedures follow the same principles of conventional PCR in the preparation of mixes and cycling of temperature. This rapid detection method uses a detection format, usually a fluorescent dye that binds to the PCR product. The amount of fluorescence generated is proportional to the amount of PCR product formed. Initially the signal is weak and therefore undistinguishable from the background but as the PCR product accumulates, the fluorescence can be acquired by the real time PCR device. A threshold line is developed by the real time device and the CT value is determined. CT value is the number of cycles required to reach fluorescent threshold. Real time PCR generates a CT value for each DNA sample which is therefore proportional to the copy number DNA.

Figure X: Real time PCR response curves indicating threshold level.

Commonly used fluorescent Reporters

SYBR Green 1.

Asymmetric cyanine dyes such as SYBR Green 1 have two aromatic systems containing nitrogen, one that is positively charged connected by a methine bridge. The dye has virtually no fluorescence when free in solution due to vibrations engaging both aromatic systems, which convert electronic excitation energy into heat that dissipates to the surrounding solvent. When the dyes bind with DNA they emit fluorescence. (Nygren et al 1998)

As disussed by LightCycler Rea time PCR Systems (2009), SYBR Green binds to all double stranded DNA molecules regardless of the sequence. When it comes into contact with double stranded DNA its fluorescence increases significantly. According to Monis et al (2005) SBYR Green 1 has a limitation in dye stability and dye dependant PCR inhibition and the selective detection of amplicons during DNA melting curve analysis.

HYBRIDISATION PROBES

HYDROLYSIS PROBES

TAQMAN PROBES

LUX PRIMERS

SYBR Green 1 is commonly used in real time PCR. However, these asymmetric dyes however are considered sequence non-specific reporters in real-time PCR. They tend to emit fluorescence signal to all double stranded DNA even undesirable primer-dimer products. Primer dimer products interfere with the formation of specific products due to competition of the two reagents and may lead to incorrect readings. Melting curve analysis can easily recognise primer-dimer formation. Temperature is increased and fluorescence is measured as a function of temperature. As temperature increases, fluorescence decreases due to increased thermal motion. When double stranded DNA separates an abrupt drop in the fluorescent signal occurs. Since primer-dimers are shorter and they tend to melt at a lower temperature, they are easily recognised in melting curve analysis.

LUX primers:

PRINCIPLE

STRUCTUE

EXAMPLES: BACTERIOLOGY ND VIROLOGY

Light Upon Extension (LUX primer): based on oligonucleotides labelled with a single fluorophore. They do not require a quencher moiety

includes a single-labeled primer with a FAM fluorophore at the 3′ end in a hairpin structure and a corresponding unlabeled primer, designed to amply the 5′ end of the gene encoding the S protein of TGEV. The configuration of the labeled primer enables the fluorescence quenching capability. When the primer is incorporated into double-stranded RT-PCR product, the fluorophore is dequenched, resulting in a significant increase in fluorescent signal

Unlike the current well known real-time technology that relies on a synthetic DNA probe labeled with two different fluorescent dyes, LUX primers technology does not require an expensive probe so is more suitable for routine laboratory diagnosis. What a LUX assay needs is a specific primer set with a single labeled, self-quenched primer and a corresponding unlabeled one, it is more reliable than the real-time method using DNA binding dyes that may produce potentially misleading results due to the lack of specificity of the dyes. A previous study also indicates that the LUX primers technology is reliable for quantitation of gene expression and the result is similar to the probe-based quantitative assay (Brian et al., 2003). LUX fluorogenic primers can be designed and ordered via online software. 

The LUX assay also has the advantage of increase speed and is less laborious over the gel-based RT-PCR technique that is currently the routine gene analysis tool for TGEV. The LUX assay took less than an hour to complete the amplification reaction and the process was viewed in real time, while conventional RT-PCR methods usually take more than 1 h for gene amplification and half an hour or more to run the gel and examine the result. The advantage of speed of the LUX assay is more apparent when compared to other routine diagnostic methods for TGE

Furthermore, the LUX assay is closed-tube and one-step technique, which reduces the risk of contamination and reaction variability. This sensitive and specific test complements existing gene methods for the detection of TGEV. The method shall prove to be a valuable tool in the laboratory diagnosis of TGEV, especially as a means of confirming positive results from serological tests.

LUX primers technology supports multiplex amplification (http://www.invitrogen.com/lux) that makes detecting different pathogens in a single assay possible. By using two sets of primers, each labeled with a different dye, a single LUX assay can detected two different viruses.

LUX primers are compatible with a wide variety of real-time PCR instruments (http://www.invitrogen.com/lux). More assays can be developed for the detection of other pathogens. By reducing the cost of real-time gene detection and with high performance, LUX fluorogenic primers technology may has the potential to be used widely in the field of animal disease surveillance and control as well as import and export animal quarantine management.

Advantages of using DNA for microbial Testing

DNA is stable and uninfluenced by environmental factors while being independent from bacterial constitution making results conclusive not subjective. It is accurate due to species specific target sequence which is unachievable with cultural methods and performance controls can be added. There are well established DNA detection methods available which enable fast detection. Dependable manufacture of primers and probes.

(Kenyon College 2010)

http://www.appliedbiosystems.com/support/tutorials/pdf/rtpcr_vs_tradpcr.pdf

http://www.nature.com/leu/journal/v17/n6/fig_tab/2402922f1.html#figure-title

Materials and Methods

2.1 Preparation of DNA from bacterial strains

The following Enterobacteriaceae strains were obtained (MicroBioLogics Inc, Minnesota, USA) Escherichia coli (ATCC 11775), Serratia marcescens (ATCC 13880), Enterobacter aerogenes (ATCC 13048), Salmonella typhimurium (ATCC 13311) Erwinia persicina (ATCC 1381) Shigella flexneri (ATCC 9199) Klebsiella pneumonia (ATCC 700603), Yersinia enterocolitica (ATCC 9610) Listeria monocytogenes (ATCC 19115), Vibrio parahaemoliticus (ATCC 17802), Aeromonas hydrophila (ATCC 7966) and Campylobacter jejuni (ATCC 29428). The University of Limerick supplied the strains Cronobacter sakazakii, Enterobacter cloacae, Pseudomonas aeruginosa and Proteus mirabilis. The National Collection of Type Cultures (Health Protection Agency Culture Collections, Salisbury, UK) supplied Staphylococcus aureus (NCTC 8325). All strains of bacteria were stored on Protect beads 109 (LangenBach services Ltd, Dublin, Ireland) at -20°C until cultivation. All Enterobacteriaceae strains grown on nutrient agar (NA) (Oxoid, Basingstoke, UK) at 37°C for 24hr ± 2 hrs except Erwinia persicina which was grown at 30°C, Listeria monocytogenes and Staphylococcus aureus grown at 37°C. Vibrio parahaemoliticus grown at 35°C on Trypic soya agar (TSA) (Oxoid)

Verification and Identification of the reference microorganism E coli.

The identification of Escherichia coli (ATCC 11755) was verified by the following biochemical tests. The Gram stain procedure was applied to a colony from the fresh culture on NA. Oxidase test was carried out using oxidase strips (bioTRADING, Dublin, Ireland). A positive control of Pseudomonas aeruginosa and a negative control of Staphylococcus aureus were used to confirm the reliability of the test. API identification using ID 32E was carried out according to manufacturer's instructions (BioMerieux®S.A, Craponne, France) and identified using the software Apiweb (BioMerieux)

2.2 Preparation of bacterial suspension.

Pre-cultures were prepared by inserting a loop full of bacterial colony into Nutrient Broth( Oxoid) with incubation of 37°C for all Enterobacteriaceae with the exception of Erwinia persicina which was grown at 30°C, Listeria monocytogenes and Staphylococcus aureus grown at 37°C. A loop full of Vibrio parahaemolyticus was grown at 35°C on Tryptic Soya Broth (TSB) (Oxoid)

In particular the growth of Escherichia coli in nutrient broth was studied by measuring the optical density and plate counting. Spectrophotometric measurements were obtained at 600nm using (insert name here).Optical density was acquired every 30min from 0min to 4h 30min

2.3 Usual spiking of coupons and recovery by swabbing.

Stainless steel coupons of grade 304 were obtained. Regions to be spiked with Escherichia coli were indicated using a template () (10cm x 10cm). Each coupon was spiked by pipetting 100µl of Escherichia coli culture onto the surface and using a spreader ().

After allocated time (0min 30min or 60min), coupons were swabbed using cotton swab. Each coupon was swabbed twice: horizontally and vertically. Each swab was cut and placed into the inner tube of swab extraction tube system (SETS) (Roche Diagnostics, Mannheim, Germany).Each collection tube was subsequently centrifuged at 10000g for 10min (Sigma1-15). Then the inner tubes and the supernatants were discarded. Pellets were re-suspended in 250µl Ringer quarter strength solution (Oxoid). Dilution series in quarter strength ringer solution were prepared, plated out on nutrient agar and incubated 18-24h at 37°C.

2.4 Study of the release of Bacteria from different swabs and sponges.

Comparative study of the recovery of Escherichia coli cells was performed using cotton, rayon and alginate swabs. (Copan Italia S.p.A, Brescia, Italy). 100µl of 18h Escherichia coli culture were deposited directly onto each swab. Swabs were cut and placed into SETS tubes. Tubes were centrifuged at 10000 g for 10 min. Pellets were re-suspended with 200µl of quarter-strength Ringer Solution (Oxoid). Dilution series were made and 100 µl of diluted sample were plated onto nutrient agar plates (Oxoid) that were incubated at 37°C for 24 h.

Large sponges (Medical Supply Co Ltd, Dublin, Ireland) were tested to recover bacteria from surfaces by swabbing after allocated time (0 min, 30 min, 60 min). Each sponge impregnated with 10ml Maximum Recovery Diluent (MRD) (Oxoid) was inserted into a stomacher bag () supplemented with 100ml of MRD and stomached using stomacher () for 120 s at high power. Dilution series were made and 100µl of diluted sample was plated onto nutrient agar plates (Oxoid) that were incubated at 37°C for 24 h

2.5 Detection and Quantification of viable bacteria from surfaces.

Plate counting formula was obtained as per ISO 4833:1991 (Harrigan W.F 1998) which has since been renewed to ISO 4833:2003 'Microbiology of food and animal feeding stuffs -- Horizontal method for the enumeration of microorganisms -- Colony-count technique'. The plate counting formula was ∑c/ (n1 + 0.1 n2)d where ∑c was the sum of all colonies counted on all dishes, n1 was the number of dishes in 1st dilution, n2 was number of dishes in 2nd dilution and d represented the dilution. Miles and Misra method as per Harrigan W.F (1998) was used in particular when testing recovery of Escherichia coli from the large sponges.

2.10 Bacterial identification of bacteria in the suspension used to create the artificial food environment on surfaces.

The suspension was prepared from 34 swabs samples that were collected from food contact surfaces in Dawn Fresh Food Company, Fethard, Co. Tipperary. Each swab was mixed with 0.1% peptone water (Oxoid) and the suspension were pooled together to create one main suspension that was mixed with half volume glycerol 50% (Sigma Aldrich™ Inc). This suspension was aliquoted into 1ml eppendorf tubes and kept in at -80°C. A total viable count was determined by using the Miles and Misra method and subsequently by plate counting following a dilution series of bacterial suspension. The detection of Listeria monocytogenes, Staphylococcus aureus and the Enterobacteriaceae were targeted.

In the case of Listeria monocytogenes 1ml of sample was dispensed into 9ml Buffer Peptone water (Oxoid). Incubate 37°C for 18-24hours. After 24 h transfer 10ml from tube into 90ml of Listeria Enrichment broth (Oxoid), incubate for 48 h at 30°C ensuring agitation. After 48 h a loop full of solution was streaked on a Listeria agar plate (Oxoid) and incubated for 48 h at 30°C. Listeria Petrifilm (3M™, Dublin, Ireland) was used following manufacturer's instructions. For the identification of Staphylococcus 100µl of artificial food environment was plated on baird parker agar (Oxoid) distributing the organic load throughout the plate using a spreader and incubated at 37°C for 48 h. After 48 h agglomeration was tested using Pastorex® Staph Plus test. (Biorad). Catalase activity was tested by the addition of H2O2 (). Each suspected Staphylococcus aureus colony was placed in 1ml of ringer solution that was subsequently pipetted onto Staph Petri film (3M™). Petri film was placed in incubator for 24 h at 37 °C.

Enterobacteriaceae was detected using most probable number (MPN) See appendix.

2.6 DNA extraction:

For specificity for PCR assays, bacterial pellets were obtained previously from cultures in exponential growth phase were used with the exception of Camplyobacter jejuni. One colony of C.jejuni was resuspended in 0.1% Peptone water (Oxoid) and centrifuged at 5000 g for 5 min. For the quantification of bacteria from surfaces, pellets were recovered from SETS after centrifugation of 1ml of culture at 5000 g for 5 min. A rapid purification of DNA samples using DNeasy Blood and Tissue Kit (Qiagen, West Sussex, UK) was preformed following manufacturer's instructions. DNA was extracted, purified and subsequently quantified using Nanodrop ND 1000 spectrophotometer (ThermoScentific, Wilmington, USA) DNA concentrations were adjusted to 1ng per 2µl

2.7 Selection of Primer sets.

2.7-1 ENT Primers

ENT primers developed by Nakano et al (2003) and designed to anneal to the 16S rRNA gene of Escherichia coli. The sequence of the forward primer: 5'GTTGTAAAGCACTTTCAGTGGTGAGGAAGG 3'was 425 through 454 in the E. coli 16S rDNA while the sequence of the reverse primer 5'GCCTCAAGGGCACAACCTCCAAG 3' had positions 826 through 848 in the E.coli 16S rDNA. ENT primers expected to lead to formation of 419-425 bp of PCR product.

2.7-2 IEC primers:

IEC primers as described by Khan et al (2007)are oligonucleotide primer pairs derived from the distal and proximal conserved flanking regions of the16S rRNA gene, the Internal Transcribed Spacer (ITS) region and the 23S rRNA.IEC forward primer 5'CAATTTTCGTGTCCCCTTCG 3' and reverse primer 5'GTTAATGATAGTGTGTGTCGAAAC 3' had expected PCR product length of 450bp.

2.8 PCR Conditions

For a single PCR 25 µl PCR reaction, PCR master mixes were prepared with sterile DNA water, PCR buffer 2mM MgCl2, 25mM MgCl2, a dNTP mixture (dATP, dTTP, dCTP,dGTP), forward primer, reverse primer, DNA polymerase and 2µl of particular DNA. PCR was carried out on G-STORM GS2 Thermal Cycler. (Genetic Research Instrumental Ltd, Braintree, UK).

The amplification conditions were as follow: close lid and heated to 111°C, 95°C for 6 min, bacterial cycle start of 28ycles, denaturation step of 95°C for 30 s, annealing temp between gradient of 56-62°C depending on primer type for 15 s, elongation for 30 s at 72°C. End cycle with elongation for further 7 min at 72°C.

Cycle was repeated 30 times. 2% Agarose gel (Biosciences, Dun Laoghaire, Ireland) pre-stained with SYBR Safe™ (Molecular Probes, Eugene, USA) electrophoresis was run in Tris acetate EDTA (TAE).(Sigma Aldrich™ Inc, Saint Louis, USA) with Amplisize (Biorad, Hercules, USA) as a molecular marker ranging from 50 to 2000 bp. The gel was examined in G-BOX (Syngenes, Cambridge, UK) under UV light.

Recovery of E coli in the presence of an artificial food environment

Innoculum was prepared with pre-culture at the exponential phase when the concentration was 108cfu/ml. 100µl was pipetted onto stainless steel coupons containing different concentrations of artificial food environment (high, medium or low concentrations). After allocated time (0 min, 30 min, 60 min) coupons were swabbed at 90°angle. Swabs were cut into SETS (Roche Applied Science) and centrifuged for 10 min at 6000g. Pellet was re-suspended with 150µl ringer solution allowing 50µl for EMA treatment and 50µl for plate counting.

Preparation of Propidium monoazide (PMA)

PMA dissolved in 20% DMSO to obtain a stock concentration of 20nM and stored at -20°C away from the light. 1.25µl PMA solution added to 500µl of culture aliquots to give a final concentration of 50nM following the incubation period of 5minutes in the dark with occasional mixing to allow the PMA to penetrate the dead cells and to bind to the DNA. Samples are then put in ice and placed 20cm from 500W halogen light source for 15minutes. Samples centrifuged at 10,000g for 10 minutes. Samples washed with NaCl() and MilliQ water() in order to remove the inactivated PMA.

Reagent D (Biotecon Diagnostics)

.

APPENDIX

Bacteria

Family/ Class

Escherichia coli

Enterobacteriaceae

Erwinia percisina

Enterobacteriaceae

Servatia marcesens

Enterobacteriaceae

Enterobacter aerogenes

Enterobacteriaceae Class 2

Klebsiella pneumonia

Enterobacteriaceae Class 2

Shigella flexneri

Enterobacteriaceae Class 2

Yersinia enterocolitica

Enterobacteriaceae Class 2

Salmonella typhimurium

Enterobacteriaceae Class 2

Cranobacter sakazakii

Enterobacteriaceae Class 2

Proteus mirabilis

Enterobacteriaceae Class 2

Enterobacter cloacae

Enterobacteriaceae Class 2

Listeria monocytogenes

Non Enterobactericeae Gram + Class 2

Bacillus cereus

Non Enterobactericeae Gram + Class 2

Vibrio parahaemoliticus

Non Enterobactericeae Gram - Class 2

Staphylococcus xylosus

Non Enterobactericeae Gram +

Staphylococcus capitis

Non Enterobactericeae Gram +

Micrococcus spp

Non Enterobactericeae Gram +

Campylobacter jejuni

Non Enterobactericeae Gram -

Staphylococcus aureus

Non Enterobactericeae Gram +

Pseudomonas auruginosa

Non Enterobactericeae Gram -

Staphylococcus lentus

Non Enterobactericeae Gram +

Aeromonas hydrophila

Non Enterobactericeae Gram -

Bacteria

[Conc] ng/µl

Absorbance @260nm

Absorbance @ 280nm

260/280

Staphylococcus capitis

6.2

0.124

0.065

1.90

Klebsiella pneumoniae

28.4

0.568

0.278

2.05

Cranobacter sakazakii

27.7

0.553

0.283

1.95

Salmonella typhimurium

34.7

0.695

0.345

2.02

Shigella flexneri

60

1.199

0.555

2.16

Micrococcus spp

3.5

0.071

0.035

2.04

Vibrio parahaemoliticus

540.9

10.81

5.045

2.14

Proteus mirabilis

144.9

2.899

1.309

2.21

Staphylococcus lentus

15.7

0.314

0.167

1.88

Listeria monocytogenes

37

0.741

0.334

2.22

Campylobacter jejuni

83.1

1.662

0.777

1.68

Erwinia percisina

320

6.4

2.939

2.18

Bacillus cereus

116.9

2.337

1.074

2.18

Servatia marcesens

199.5

3.99

1.827

2.18

Yersinia enterocolitica

172.5

3.451

1.564

2.21

Aeromonas hydrophila

33.9

0.677

0.352

1.93

Escherichia coli

13.2

0.264

0.132

2

Staphylococcus xylosus

6.5

0.129

0.069

1.88

Staphylococcus aureus

9.5

0.190

0.096

1.98

Pseudomonas auruginosa

26.7

0.534

0.279

1.91

Enterobacter aerogenes

109.7

2.194

0.994

2.21

Enterobacter cloacae

24.8

0.234

0.496

2.12

Detection of Enterobacteriaceae:

Test portion 1ml + 9ml BPW

Incubate at 37°C for 18h ± 2h

1ml of culture + 10ml of EE broth

Incubate at 37°C for 24 h ± 2h

Streak onto plates containing VRBG agar

Incubate at 37°C for 24h ± 2h

Select characteristic colonies and streak onto nutrient agar

Incubate at 37°C for 24h ± 2h

Confirm Enterobacteriaceae by -Oxidase reaction (-) -Fermentation of Glucose (+)