Acetylsalicylic acid plus diclofenac in OA

Published:

Acetylsalicylic acid combined with diclofenac inhibits cartilage degradation in rabbit models of osteoarthritis

Running title: Acetylsalicylic acid plus diclofenac in OA

Highlights:

1. Acetylsalicylic acid combined with diclofenac reduces the content of NO and IL-1β.

2. Acetylsalicylic acid plus diclofenac inhibited MMP-3 and MMP-13 protein expression.

3. PCR found that mRNA expression of TIMP1 was up-regulated.

Abstract

Objective: This study was aimed to explore the effect of different concentration of acetylsalicylic acid combined with diclofenac on articular cartilage of rabbit models of osteoarthritis (OA).

Methods: Total 40 New Zealand white rabbits were divided into 5 groups (A, B, C, D and E). Group A was sham-operation normal control group which was treated with normal saline. Group B, C, D and E were OA model groups and were respectively treated with normal saline and acetylsalicylic acid combined with diclofenac of 5 mg/kg, 10 mg/kg and 20 mg/kg. Cartilage macroscopic examination and pathological observation were performed to analyze the structure of articular cartilage in all the groups of treatment. The content of nitric oxide (NO) and interleukin 1β (IL-1β) were detected by enzyme-linked immuno sorbent assay (ELISA). The protein expression of matrix metalloproteinase 3 (MMP-3) and MMP-13 were detected by western blot. The mRNA expression of the tissue inhibitor of metalloproteinases 1 (TIMP1) was detected by polymerase chain reaction (PCR).

Lady using a tablet
Lady using a tablet

Professional

Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

Results: The different concentrations of the drugs reduced the scores of cartilago articularis, the content of NO and IL-1β, and protein expression of MMP-3 and MMP-13. PCR found that mRNA expression of TIMP1 was up-regulated.

Conclusion: The administration of different concentrations of acetylsalicylic acid combined with diclofenac plays preventive or therapeutic effects on progressive OA.

Key words: acetyl salicylic acid combined with diclofenac; osteoarthritis; interleukin 1β; nitric oxide; matrix metalloproteinase

1. Introduction

Osteoarthritis (OA) is one of the most common degenerative joint disease in older adults, characterized by cartilage abrasions and degradation, subchondral bone remodeling, osteophyte formation, and low-grade inflammation [1, 2]. OA is considered to be induced by several complex interactions and cross-talk involving proteoglycan degradation, progressive erosion of articular cartilage, and disruption of the collagen network, which lead to pain, stiffness, and chronic physical and functional disability [3-5]. For instance, cytokines interleukin 1β (IL-1β), inducible nitric oxide synthase (iNOS), and consequent matrix metalloproteinases (MMPs) are important catabolic factors for the erosion and proteolysis of extracellular matrix components of the cartilage [6, 7]. Consequently, how to down-regulate the catabolic factors become an important target for research on optimal treatments of OA.

Currently, pharmacological therapeutic agents for OA represent the mainstay of treatment, which primarily include analgesics and non-steroidal anti-inflammatory drugs, such as acetylsalicylic acid and diclofenac [8]. Acetylsalicylic acid exerts anti-inflammatory, analgesic and antipyretic actions and is the most widely used drug in clinical pain of osteoarthritis [9]. Diclofenac, a non-steroidal anti-inflammatory drug, can generally decrease pain and stiffness and improve function and has been extensively used in the management of osteoarthritis [10]. Importantly, the two kinds of drugs have been linked to increased bone mineral density, which potentially decreased the fracture risk [11-13].

Lady using a tablet
Lady using a tablet

Comprehensive

Writing Services

Lady Using Tablet

Plagiarism-free
Always on Time

Marked to Standard

Order Now

In view of the effects of acetylsalicylic acid or diclofenac alone on OA, we investigated the protective effects of various doses of acetylsalicylic acid combined with diclofenac on the standard rabbit anterior cruciate ligament transection (ACLT) model of OA. Furthermore, we comprehensively evaluated the production of catabolic factors including IL-1β, nitric oxide (NO), MMP-3 and MMP-13 to investigate the mechanism of the two kinds of drugs in combination on OA. We speculated that the administration of larger dose of acetylsalicylic acid in combination with diclofenac would have better roles in the progression of cartilage degradation and pathogenesis of OA.

2. Materials and methods

2.1 Experimental animal model

Forty healthy adult New Zealand whiterabbits (20 female and 20 male) of mean weight 2.5 ± 0.5 kg were purchased from the animal center of Shandong University and used in this study. This study fully complied with the national legislation and the Guide for the Care and Use of Laboratory Animals issued by the Ministry of Health of the People’s Republic of China and was approved by the local research ethical committees.

All rabbits were anesthetized by an ear marginal vein injection of pentobarbital (30 g/L).Thirty two rabbits were randomly selected to induce OA model. For each of the 32 rabbits, a medial parapatellar incision was made through the skin of left hind limb knee. Then, ACLT [14-16] and complete meniscectomy were performed to induce left hind limb knee OA. The other 8 rabbits were sham-operation group. They were also made a medial parapatellar incision but not performed ACLT and meniscectomy. Each animal received antibiotic prophylaxis with intramuscular injection of gentamicin (0.48 g per day) for 5 days following surgery.

The 8 rabbits treated with sham-operation was regarded as group A and the other 32 experimental animals were randomly assigned to 4 groups (B, C, D and E). Group A and B were respectively normal control and model control, which were treated with normal saline; group C was treated with low-dose acetylsalicylic acid (purity > 98%, Sangon Bictech Corporation, Shanghai, China) combined with diclofenac(purity > 98%, Sangon Bictech Corporation, Shanghai, China) (5 mg/kg; acetylsalicylic acid: diclofenac = 1:1); group D was treated with median-dose acetylsalicylic acid combined with diclofenac (10 mg/kg; acetylsalicylic acid: diclofenac = 1:1); group D was treated with large-dose acetylsalicylic acid combined with diclofenac (20 mg/kg; acetylsalicylic acid: diclofenac = 1:1). These different concentration of drugs were given through intraperitoneal injection for 4 weeks.

2.2 Macroscopic examination of the cartilago articularis

The knee articular cartilage tissues were macroscopically scored with scoring systems as described previously by Pelletier et al. [17], as follows: 0 = articular cartilage surface is smooth and appears light blue or colorless translucent; 1 = articular cartilage surface is malacic but smooth; 2 = articular cartilage tends to thin and appears small fibre bundle; 3 = articular cartilage appears obvious fibre bundle; 4 = articular cartilage appears wear and tear of fibre bundle accompany with the subchondral bone exposure and osteosclerosis.

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

2.3 Cartilage pathological observation

After sacrifice, the left hind limb knee joints of the 40 rabbits were resected and immediately fixed in 4% paraformaldehyde for 24 h. The tissues were then decalcified in 10% ethylenediaminetetraacetic acid (EDTA) decalcifying solution (pH 7.2-7.5; containing 0.01% sodium azide ) for 12 weeks and the decalcifying solution was changed every 3 days. After decalcification, the tissues were embedded in paraffin and cut into 4-μm-thick sections for histological evaluation. The sections were stained with hematoxylin and eosin (HE). All the sections were observed using 1×70 inverted phase contrast microscope (TS100, Nikon Corporation, America).

2.4 Determination content of NO and IL-1β

The rabbit knee joint cavity was injected with 1.0 ml normal saline. Then the joint fluid was drained repeatedly and injected into the test tube. The detection method was according to the instruction of NO and rabbit IL-1β enzyme-linked immuno sorbent assay (ELISA) kit.

2.5 MMP-3 and MMP-13 protein expression analysis

Western blot was used to determine the protein expression. Briefly, about 20 mg femoral cartilage degeneration part tissue samples of rabbits were cut into pieces and placed in the homogenizer. Then 1 ml TRIzol reagent (Becton Dickinson, America) and 40μl 10mmol/L phenylmethanesulfonyl fluoride were added to the culture flask and kept in an ice bath for 10 min. The tissue lysates were added to eppendorf tube and kept in an ice bath for 30 min. The supernatants were collected by centrifugation at 12000 g for 15 min. The total protein concentrations of collected supernatants were measured by bicinchorinic acid assay (BCA). The samples were separated on 12% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). Then the proteins band were transferred to polyvinylidene fluoride membranesand were blocked for 1 h at room temperature. Membranes were further incubated with rabbit anti-human MMP-3 and MMP-13 antibodies and rat anti-human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibodies (1:500; Becton Dickinson, America) at 4℃ overnight. After washing, the membranes were subsequently incubated with secondary antibodies (1:1000; Zemai Biotech Corporation, Shanghai, China) for 1 h at room temperature. The reaction was visualized using the enhanced chemiluminescence detection system.

2.6 Tissue inhibitor of metalloproteinases 1 mRNA expression analysis

Total RNA was extracted from femoral cartilage degeneration part tissue of rabbits using TRIzol reagent (Becton Dickinson, America) according to the manufacturer’s instructions. After measuring the total RNA, RNA was subjected to reverse transcription (RT) into cDNA according to the manufacturer's instructions of PrimeScript RT reagent kit (Code No.9160; Sigma, America): 2 µl 5 × PrimeScript Buffer, 0.5 µl PrimeScript RT Enzyme Mix, 2 µl Total RNA and 5 µl RNase Free dH2O (final volume 10 µl) reacted at 37℃ water bath for 15 min, then reacted at 85℃ for 15 s. The tissue inhibitor of metalloproteinases 1 (TIMP1) primer (5'-3') was GTCGCATGCTGCGAGTTGAC, GGGTGGCCAAGAGCCTTGT. Real-time fluorescent quantitation polymerase chain reaction (PCR) was performed according to SYBR Premix Ex Taq TM II (Perfect Real Time) (Code No. RR041A; Sigma, America) using the ZY325161 Real-Time PCR machine (Eppendorf, Germany). Briefly, 2 µl of cDNA was mixed with 12.5 µl SYBR Premix Ex Taq, 1 µl PCR Forward Primer, 1 µl PCR Reverse Primer, 8.5 µl dH2O (final volume 25 µl). The PCR cycling conditions were 40 repeats of 95℃ for 5 min, 95℃ for 20 s, 60℃ for 30 s and 72℃ for 20 s, and 71 repeats of 60-95℃ for 20 s with temperature rise by 0.5℃ for each repeat. The mRNA levels of samples were normalized to the GAPDH mRNA levels as an internal control and the primer (5'-3') was ACGTCCCATCACGATCCTTC, ACACTCGGATGACGAACT. Finally, 10µl PCR products were performed 1% agarose gel electrophoresis.

2.7 Statistical analysis

Data are expressed as the means ± standard deviation (SD), and statistical analysis was carried out with SPSS version 13.0 software for Windows. The pairwise comparison of multiple samples used Bonferroni Test of One-way ANOVA. A value of P < 0.05 was considered to indicate statistical significance.

3. Result

3.1 Macroscopic examination of the cartilago articularis

The cartilago articularis of group A was scored 0, of which cartilago articularis surfaces were neat surface without cracks, defects, softening and osteophyte. Group B was scored 3.9, of which cartilago articularis surfaces appeared obvious fibre bundle, cracks, defects and softening, besides, part of the subchondral bones exposed with osteophyte along the edge. After rabbits were treated with drugs, cartilago articularis surfaces became more smooth with small fibre bundle, capilar cracks, besides, the degree of cartilage wear and osteophyte formation was significantly declined compared with the model control of group B. Group C was scored 3.1, group D was scored 2.5, and group E was scored 1.8 (Figure 1).

3.2 Cartilage pathological observation

For the normal control of group A, the articular cartilage surfaces were neat, translucent, shiny and flexible without cracks, defects, softening and osteophytes. For the model control of group B, the articular cartilage surfaces were rough without normal luster and elasticity, besides, the surfaces appeared obvious fibre bundle, cracks, defects, softening, and part of the subchondral bones exposed with osteophyte along the edge. For the large-dose treatment of group E, the articular cartilage surfaces appeared yellowandwhite and partly loss of normal luster, besides, the surfaces became more smooth with small fibre bundle, capilar cracks and the degree of cartilage wear and osteophyte formation was significantly declined compared with group B, low-dose and median-dose treatment groups (Figure 2).

3.3 Effects of drugs on the content of NO and IL-1β in joint fluid

The contents of NO (5.97 ± 0.9) and IL-1β (7.03 ± 0.8) in group A were significantly (P < 0.05) less than in group B (NO: 13.21 ± 1.2, IL-1β: 15.43 ± 1.4). After rabbits were treated with different doses of drugs, contents of NO and IL-1β in all the 3 groups declined significantly(P < 0.05), especially for large-dose treatment of group E (NO: 7.32 ± 0.6, IL-1β: 8.43 ± 0.4) (Figure 3).

3.4 Effects of drugs on MMP-3 and MMP-13 protein expression

Figure 4 showed that the protein expression levels of MMP-3 and MMP-13 were high in group B. After rabbits were treated with drugs, the expression levels of MMP-3 and MMP-13 in all the 3 groups declined, especially for large-dose treatment of group E.

3.5 Effects of drugs on TIMP-1 mRNA expression

The mRNA expression levels of TIMP-1 were shown in Figure 5. The expression levels of TIMP-1 in group C, D and E (C: 0.42 ± 0.01, D: 0.55 ± 0.02, E: 0.73 ± 0.01) declined significantly (P < 0.05) compared with in group B (0.31 ± 0.00). Besides, the effects enhanced with the increase of the concentration.

4. Discussion

OA is presently considered as a global organ failure involving all the tissues of the joint [18]. The treatment of OA has generally been aimed at alleviating pain, swelling and muscle tightness to improve the mobility [3]. Numerous OA patients have experienced relief of joint pain and improvement in mobility as a result of taking acetylsalicylic acid or diclofenac. In this study, we examined the effects of different concentrations of acetylsalicylic acid combined with diclofenac on the OA rabbit model. We found that drugs in 3 groups of concentrations reduced the cartilago articularis scores and reduced the content of NO and IL-1β. In addition, the expression of MMP-3 and MMP-13 protein was down-regulated and mRNA expression of TIMP1 was up-regulation of mRNA expression.

For the present study, cartilage macroscopic examination and pathological observation were performed to analyze the structure of articular cartilage in all the groups of treatment. The scoring system [17] is widely used for evaluating histologic findings of osteoarthritic specimens and the osteophyte formation and cartilage lesions have long been used as observation indexes [19, 20]. The scoring result showed a significant inhibition of degenerative changes in the cartilage by drugs treatment (Figure 1), which was consistent with the histologic assessment (Figure 2). These results may indicate that administration of acetylsalicylic acid combined with diclofenac has a effect on the development of cartilage degenerative changes.

Proinflammatory cytokine of IL-1β exerts a catabolic effect on the chondrocyte metabolism, which decreases proteoglycan collagen synthesis and increases aggrecan release via blocking proteases [21]. In addition, IL-1β may activate synovial cells to increase the gene expression of MMPs which are catabolic factors for the erosion and proteolysis of extracellular matrix components of the cartilage [6]. IL-1β also induces synovial cells and chondrocytes to produce other inflammatory mediators such as IL-6, IL-8 and NO [22]. NO is a highly reactive free radical as well as a major catabolic factor synthesized from the L-arginine by the members of iNOS [23, 24]. Overproduction of NO results in tissue damage and inflammatory response, which plays an important role in the pathogenesis of inflammation [25]. Zhou et al. [24] suggested that NO led to articular chondrocytes apoptosis by the inhibition of protein kinase C which participated in modulating articular chondrocytes apoptosis. In the present study, acetylsalicylic acid plus diclofenac significantly inhibited the IL-1β and NO production, suggesting that the inhibition of the inflammatory mediators may be responsible for the anti-inflammatory effects of acetylsalicylic acid plus diclofenac.

For the other catabolic factor of IL-1β, MMPs comprise a family of Zn2+ dependent extracellular enzymes containing combined ability of degrading extracellular matrix components as well as remodelling normal and pathological tissue [26, 27]. MMPs are demonstrated to be involved in bone resorption and matrix degradation [28, 29]. As an array of proteases, MMPs can break down proteoglycans and type II collagen which are the main components of the articular cartilage, leading to proteolysis of cartilage [26]. Specially, MMP-3 has ability to degrade various components of cartilage, and MMP-13 is capable of degrading intact type II collagen [27, 30]. The increased amounts of proMMPs and MMP production have been found in synovial fluid and joint pathology [31-33]. Importantly, research found that cartilage degradation occurs not only as a result of the increase of MMPs but also because of an imbalance between extracellular matrix proteinases and their inhibitors, in particular MMPs and TIMPs [34]. MMPs are inhibited by specific endogenous TIMPs which are glycoproteins and inhibit all MMPs on a 1:1 basis by forming high-affinity complexes [35]. Specially, TIMP-1 inhibits MMP-1, MMP-3, MMP-9 and MMP-13 [36]. The result of western blot analysis found that the protein expressions of MMP-3 and MMP-13 were down-regulated after administrating drugs, especially for large-dose treatment. Moreover, result of PCR found that mRNA expression of TIMP1 was up-regulated after rabbits were treated with drugs, besides, the effects enhanced with the increase of the concentration. These results indicated the roles of acetylsalicylic acid combined with diclofenac in alleviating the destruction of articular cartilage matrix and delaying the process of osteoarthritis.

In conclusion, our findings indicate that the administration of acetylsalicylic acid combined with diclofenac plays preventive or therapeutic effects on progressive OA. This results may be achieved by inhibition of the expression of MMP-3 and MMP-13 and increase of the expression of TIMPs to inhibit the degration of extracellular matrix components and type II collagen of the cartilage. Clinical trials are needed to confirm our study in human patients with OA.