A Central Role For Mammalian Target Biology Essay


The aim of this study is to understand the interactions between LPS- provoked pro-inflammatory signaling cascades and neuronal regulatory network underlied the development of anorexia. The long-term goal is to determine the effect of i.c.v. injection 5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside (AICAR), an AMPK activator and rapamycin, an mTOR inhibitor, on LPS-induced anorexia mice. There are two parts in the research. Firstly, screen appetite regulation genes change by measuring mRNA expression and/or protein phosphorylation levels in the hypothalamus in LPS-induced mice; Secondly, confirm the critical signaling pathway by i.c.v. injection of activator/or inhibitor according to previous results. In the experiments, the gene expression of the pro-opiomelanocortin (POMC) had an increasing trend relative to control (P=0.0537) and LPS treatment significantly increased the expression of pro-inflammatory cytokines (IL-1α/ß, IL-6, TNFα). From our data, LPS (500µg/kg) administration result in lower (P<0.05) phosphorylation of AMPK, greater (P < 0.05) phosphorylation of P70S6K, FOXO1Ser256 and NFкB. LPS treatment significantly (P<0.01) increased the ratio of phosphorylated mTOR to total mTOR and the ratio of phospho-FOXO1Thr24 to total FOXO1. Stimulating AMPK signaling could not improve food intake of mice suffered LPS administration, while blocking mTOR pathway significantly attenuates LPS-induced anorexia. We identify an intrinsic counter pathway, mTOR pathway, which can relieve inflammation to alleviate the development of anorexia.


Lady using a tablet
Lady using a tablet


Essay Writers

Lady Using Tablet

Get your grade
or your money back

using our Essay Writing Service!

Essay Writing Service

Lines of evidences suggest that appetite is controlled by peripheral nerves and brain centres, such as the hypothalamus and brain stem which are responsible for integrating signals on the peripheral hormones and central neurotransmitters to achieve the goal that govern the energy balance. Two primary communities of neurons are included in the ARC to integrate signals according to nutritional status (1). In peripheral tissue, the long-term nutritional status is evaluated by insulin and leptin and these hormones could influence the central nervous system (CNS) controlled appetite. Circulating gut hormones such as ghrelin stimulates or inhibits appetite by modulating signals in CNS. In the CNS, One group consisted of the pro-opiomelanocortin (POMC) and cocaine-and amphetamine-regulated transcript (CART) is responsible for suppression food intake (2, 3). The neuropeptide Y (NPY) and agouti-related peptide (AgRP) constitute the neuronal circuit which stimulates feed behavior (4, 5). Many diseases, for instance cancer, can cause animal anorexia, which could aggravate illness and lead to death. Previous reports demonstrated that weight loss and loss of appetite is associated with inflammatory response including cancer and so on (6-9). Cancer-induced anorexia might be due to out of balance between NPY and POMC signals. When the body was injury or damage, the primary immune cells would secrete lots of pro-inflammatory cytokines such as interleukin (IL)-1, tumor-necrosis factor-α (TNF-α), IL-6. These cytokines are produced by various immune cells that are pivotal in immune response. It is reported that polypeptide cytokines influence feeding behavior (10-12). Most of our knowledge between appetite and inflammation is derived from cancer-associated anorexia. Many previously studies showed a variety of methods to attenuate anorexia induced by cancer and other diseases in vitro (13-18). The mechanism of lipopolysaccharide (LPS) - induced anorexia and the method to improve anorexia are both unclear in vivo. In this article, we mean to understand the interactions between inflammatory response induced by LPS and neuronal regulatory network underlied the development of anorexia. We try to develop the study through both AMP-activated protein kinase (AMPK) pathway and mammalian target of rapamycin (mTOR) cascades to improve LPS-induced anorexia.


Animals‒All male Kunming mice at the age of 7-10 weeks from Shandong University were housed under a controlled environment of 24℃ with12 h/12 h light/dark (L/D) cycle. Mice were allowed to standard chow and water ad libitum before starting the experiment.

Models of Animal Anorexia‒ Mice were randomly divided into four groups (n=6) and all mice were individually housed and fasted for 24h prior to the experimental day. At the start of dark cycle, mice were injected intraperitoneally LPS (from Escherichia coli 055:B5, Sigma) at dosages of 0, 10, 100, 1000µg/kg BW and were immediately given food. Food intake was recorded after 1h, 2h, 4h, 6h, 8h, 12h, 18h and 24h. Body weight was recorded at time points of 0h, 24h, 48h, 72h following injection. Finally, mice were administrated with LPS (500µg/kg). Two hours after injection, the mice were collected serum through eyes then sacrified by decapitation and quickly removed hypothalami. The collections were rapidly frozen in liquid nitrogen and then stored at -70℃ for molecular analysis.

Lady using a tablet
Lady using a tablet


Writing Services

Lady Using Tablet

Always on Time

Marked to Standard

Order Now

Gene expression analysis‒Total RNA was isolated from hypothalami, using TRIzol Reagent (Invitrgen). The integrity and concentration of RNA was assessed by measuring the optical density at 260-280nm by a biophotometer (Eppendorf, Germany). 1µg of total RNA was used for reverse transcription using PrimeScript RT reagent Kit Perfect Real Time (TaKaRa) according to the manufacture's procedures. Quantitative real-time RT-PCR (q-RTPCR) was conducted using SYBR Green I Dye (TaKaRa, China) on the Applied Biosystems Real-time PCR System 7500 (Applied Biosystems, Foster City, CA, USA). The schedule of qRT-PCR reaction included two steps: 95℃ denaturation step for 10 sec then 40 cycles of 95℃ 5 sec and 40 sec at 60℃. Primer sequences used in qRT-PCR were listed as follows: POMC (NM_008895.3) 5'-CGGGAGGCGACGGAAGAGAAAA and 5'-AACAAGATTGGAGGGACCCCTGT; NPY (NM_023456.2) 5'- CCGCCACGATGCTAGGTAACAAG and 5'-CCCTCAGCCAGAATGCCCAAAC; 5'- GCGGAGGTGCTAGATCCACAGAA and 5'- AAGGCATTGAAGAAGCGGCAGTAG for AGRP(NM_007427.2); 5'- AAGCCTGTAGCCCACGTCGTA and 5'- GGCACCACTAGTTGGTTGTCTTTG for TNF-α (NM_013693.2); IL-6 (NM_031168.1) 5'- GAGGATACCACTCCCAACAGACC and 5'- AAGTGCATCATCGTTGTTCATACA ; IL-1-α (NM_010554.4) 5'- TCGGGAGGAGACGACTCTAA and 5'- AGGTCGGTCTCACTACCTGTG ; IL-1-ß (NM_008361.3) 5'- GAAGAAGAGCCCATCCTCTG and 5'- TCATCTCGGAGCCTGTAGTG; ß-actin (NM_007393.3) 5'- ACCACACCTTCTACAATGAG and 5'- ACGACCAGAGGCATACAG. For each gene analysis, every sample was repeated at least 3 times. The house-keeping gene used for correction was ß-actin. Relative mRNA abundance was calculated through the threshold cycle numbers (CT). Data was analyzed using 2---CT.

Western blotting analysis

Total protein were extracted from hypothalami, which were lysed and homogenized in 500µl precooled Radio Immunoprecipitation Assay buffer (beyotime; P0013D) containing 50mM Tris(pH7.4),150mM NaCl,1% NP-40,0.25% sodium deoxycholate, sodium orthovanadate,sodium fluoride,EDTA,leupeptin supplemented with phosstop phosphatase inhibitor (Roche) and 1mM Phenylmethanesulfonyl fluoride (Beyotime; ST506).Then samples were centrifuged at 12000rpm for 5 min at 4℃.The protein concentrations were measured with BCA Protein Assay Kit (Beyotime; P0012) After being boiled for 10min at 100℃,the samples (30µg protein) contained 1X loading buffer were electrophoresed in running buffer on a 7.5‒12% Tri-glyline SDS-Polyacrylamide gel. The protein were transferred to polyvinylidene fluoride (PVDF) microporous membrane (Millipore) at 80V, 4℃ for 2hr. After blocking for 1h in block solution (5% BSA, 0.1% Tween-20 and 0.02% Sodium azide in PBS , PH 7.6) at room temperature, membranes were incubated at 4℃ overnight in primary antibodies against Phospho-P70S6Kinase (Thr389), Phospho-AMPKα (Thr172), Phospho-FoxO1 (Ser256), Phospho-FoxO1 (Thr24)/FoxO3a (Thr32), Phospho-FoxO3a (Ser253), Phospho-NF-κB p65 (Ser536) (93H1) Rabbit mAb, phospho-mTOR (Ser2448), P70S6Kinase, mTOR, AMPKα, FoxO1 (L27), FoxO3a, NF-κB p65 (C22B4) Rabbit mAb (Cell Signalling Technology), ß-actin mouse monoclonal (Beyotime). Blots were washed three times then soaked the membranes with anti-rabbit or anti-mouse IgG-conjugated horseradish peroxidase (Bio-Rad Laboratories) at 4℃ for 3hours. After washed three times with TBST, the immunoprecipitates were detected using Super Signal West Femto Maximum Sensitivity Sbustrate (Thermo). 5 minutes later, proteins on the membranes were visualized by exposuring to X-RAY film (Kodak). Quantification was conducted using Image J software.

Implantation of intracerebroventricular cannulae

After an overnight fast, the mice were anesthetized by intraperitoneal injection with 3% pentobarbital sodium (Merk, Germany) according to 40mg/kg body weight. Afterwards, scalp fur was shaved and coated erythromycin ointment in the eyes. Mice were put under the stereotaxie apparatus (Huai Bei Zheng Hua, China), then kept the bregma perpendicular to the device and a small midline incision was scissored on the dorsal scalp in order to have access to the cranium. The skull surface was wiped using cotton swab with 3% hydrogen peroxide. The coordinates of the third cerebral ventricle from bregma was 1.82mm posterior to bregma, 5mm ventral to the sagittal sinus. Three stainless steel screws and sufficient dental cement were used to anchor the cannula (RWD, China) to the skull. Head skin of the mice was seamed till the dental cement was dry. Mice were placed on an electric blanket and housed in individual cages and allowed for 1 week to recover before the experiment.

ICV injection

Kunming mice were fasted for 24h, randomly divided into four groups (n=6 per group) marked A, B, C, D then anesthetized with isoflurane before i.c.v. injection of AICAR (12µg/2ul) or vehicle (artificial cerebrospinal fluid, 2µl). 2h before the start of the dark cycle, group A and B were injected AICAR, the others were received ACSF. Following the infusion, the guide cannula was stayed awhile about 30s to allow the drugs to diffuse away from the cannula tip. One hour later, mice in group A and C were given intraperitoneal injection with 500µg/kg LPS, other mice were intraperitoneally injected saline. Sequently, the mice were returned to their cages and food was returned 2h later. Cumulative food intake was recorded after 1, 2, 4, 6, 12, 24h. The experiment was repeated at least three times. Two hours after intraperitoneal injection, the mice were collected serum through eyes then sacrified by decapitation and quickly removed hypothalami. The samples were rapidly frozen in liquid nitrogen and then stored at -70℃ for further analysis. Similar process was carried out in mice that were initially pre-treated with i.c.v. injection of Rapamycin(20µg/2µl) or vehicle (artificial cerebrospinal fluid, 2µl), and 1hour later with intraperitoneal injection of saline or 500µg/kg LPS. Thereafter, cumulative food intake was recorded after 1, 2, 4, 6, 12, 24h. Two hours after LPS injection, all mice were killed and rapidly removed hypothalami for molecular analysis.

Nuclear and cytoplasmic protein extract

Lady using a tablet
Lady using a tablet

This Essay is

a Student's Work

Lady Using Tablet

This essay has been submitted by a student. This is not an example of the work written by our professional essay writers.

Examples of our work

Twelve mice were randomly divided into two groups (n=6) and all mice were individually housed and fasted for 20h prior to the experimental day. At the start of dark cycle, mice were injected intraperitoneally with 500µg/kg (BW) LPS or Saline. Two hours later, mice were killed by decapitation and promptly removed hypothalami for extracting nuclear and cytoplasmic protein. Nuclear and cytoplasmic protein extractions from fresh hypothalami were conducted on the ice with the Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime; P0027) according to the manufacturers' instruction. Then protein was stored at -70℃ for molecular analysis.

Statistical analysis

All the data were analyzed using a one-way ANOVA analysis (SAS version 8e; SAS Institute, Cary. NC, USA) to evaluate the effect of LPS treatment on kinds of indices. Data were showed as the mean±SEM. P<0.05 or 0.01 was regarded as statistical significance.


LPS reduced food intake and body weight in Kunming mice

We examined the effect of LPS on bodyweight and daily food intake. Consistent with previously report (19), the body weight was dosage response. As the doses augmented, mice progressively lost bodyweight over the first 24h. Then mice administered with 10µg/kg BW LPS and 100µg/kg BW LPS returned to gain weight but those treated with 1000µg/kg BW LPS were still suffered weight lost (Figure 1A). Between 10-1000µg/kg BW LPS all caused a significantly decrease in food intake over the 24h (Figure 1B).

LPS provoke hypothalamic cytokine mRNA expression

After 100µg/kg BW LPS administration, pro-inflammatory cytokine gene expression levels of interleukin-1α (IL-1α), interleukin-1ß (IL-1ß), interleukin-6 (IL-6), tumor necrosis factor α (TNFα) were significantly increased compared with control (saline) (Figure 2 A, B, C, D).

Hypothalamic appetite gene mRNA expression

After 100µg/kg BW LPS treatment, orexigenic appetite gene mRNA expression levels of agouti-related peptide (AgRP) was significantly increased compared with control group (P<0.05; Figure 2 E), but no significant difference in neuropeptide Y (NPY) (P>0.05; Figure 2 F). In contrast, the expression of pro-opiomelanocortin (POMC) had an increasing trend relative to control (saline) (P=0.0537; Figure 2 G).

LPS inactivates AMPK but activates mTOR signaling

To explore the effect of LPS-treated Kunming mice on AMPK and mTOR signals. We conducted western blot analysis on hypothalami of mice to evaluate the phosphorylation levels of AMPK, mTOR, P70S6K. As expected, the phosphorylation level of AMPK at Thr172 is significantly decreased 2-hours after LPS (500µg/kg BW) administration (P<0.05; Figure 3 A). However, LPS led to an increase in mTOR phosphorylation and P70S6K phosphorylation as shown in Figure 3B, C. These results demonstrated that LPS treatment attenuated activity of AMPK while the activity of the mTOR pathway was enhanced.

LPS stimulates NFкB to enter into nuclear while leading FOXO1 into cytoplasm

The transcripton factor nuclear factor-кB (NF-кB) is a nulclear protein, which is normally retained inactive in the cytoplasm. As reported, LPS could activate NF-кB through enhancing phosphorylation level in hypothalamus (Figure 4A). In order to investigate whether the proportion of NF-кB is changed between nucleus and cytoplasm during LPS induced systematic inflammation in hypothamamus, we determined the protein relative content in nucleus and cytoplasm through western blot. As expected, the protein content of NF-кB in cell nuclear was significantly increased compared with in cytoplasm (Figure 4B), suggesting that intraperitoneal injection LPS stimulate NF-кB translocate into nulear. The forkhead transcriptional factor subfamily forkhead box O1 (Foxo1 or Fkhr) is a downstream target of Akt(20). Activation of Akt phosphorylates Foxo1, leading to its nuclear exclusion and pro-teosomal degradation(21, 22). Explore LPS-induced anorexia whether is mediated by FOXO1, we also determined the phosphorylation level of Foxo-1 at Ser256 and Thr24 sites. As shown in Figure 4C, D, the phosphorylation levels of Foxo-1 at these two sites were both had a significant increase under LPS treatment. Foxo-1 in cytoplasm was much more than in nuclear during LPS intraperitoneal injection (Figure 4E), indicating that Foxo1 was translocated into cytoplasm from nuclear and lost activity.

Rapamycin significantly attenuates the LPS-mediated animal anorexia

Rapamycin was used to investigate the effect on LPS-induced animal anorexia. The mice were pretreated with two concentrations of rapamycin (4µg/2ul, 20µg/2µl) for 1h, followed by intraperitioneal injection with 500µg/kg LPS. Following injection, cumulative food intake was measured. As shown in Figure 5A, the rapamycin could significantly improved food intake in a concentration-dependent manner. Administration with 20µg rapamycin blunted the effect of LPS on food intake. At the time of intraperitioneal injection 2h, hypothalami were quickly removed to determine the phosphorylation levels of mTOR, P70s6K and AMPK. And the phospho-NFкB was also evaluated using western blot methods. As reported, the rapamycin administration significantly decreased the LPS-induced protein phoshorylated levels of P70S6K (Figure 5B). And phosphorylated AMPK showed an obviously increase compared with the control group (Figure 5C).

1.7 Rapamycin prevents the effect of LPS on FOXO1

According to previously reported (23), hypothalamic Foxo1 is an important regulator of food intake and energy balance. We explored whether rapamycin could blockade the effect of LPS on the protein expression of FOXO1. The data indicated that the protein phoshorylated levels of FOXO1 showed significant decreases either at the site of Thr 24 or Ser256 within rapamycin treatment, suggesting that rapamycin inhibited the effect of LPS on FOXO1 (Figure 6A, B).

1.8 AICAR does not block the effect of LPS on food intake in mice

5-Aminoimidazole-4-carboxamide riboside (AICAR) is an adenosine analog and a widely used activator of AMP-activated protein kinase (AMPK). Although a portion of protective effects of AICAR on LPS in vitro studies was reported, the effect of AICAR on LPS-induced mice anorexia remain unclear. We employed in vivo experiment to determine the effect of AICAR on LPS-induced animal anorexia. Results of pre-treating AICAR for 1h showed that the level of AICAR did not affect LPS-induced anorexia (Figure 7A).

1.9 Phosphorylated protein level during AICAR treatment

Under administration with AICAR, the phosphorylation levels of various proteins such as AMPK, mTOR, P70S6K, FOXO1, NF-кB were determined using western blot, and there was no difference due to the AICAR treatment compared to group with LPS intraperitoneal injection alone (Figure 7 B, C, D, E, F, G).


The role of mTOR signalling in the regulation of food intake, responding to nutrient availability is widely researched (24-26). However, the function of mTOR signalling pathway in LPS-induced anorexia in Kunming mouse remains scarcely. In the present study, we demonstrated the role for the mTOR cascade in the inflammatory response to LPS-induced anorexia in mice hypothalami. In addition, LPS was associated with reducing the activity of AMPK and up-regulating mTOR signalling pathway. Our finding showed that LPS increased hypothalamic level of p-FOXO1Thr24 and Ser256 and phosphorylation level of NF-кB. I.c.v injection of activator of AMPK could not improve food intake and bodyweight but injection of inhibitor of rapamycin could relieve inflammation to alleviate the development of anorexia.

2.1 The relationship between LPS and mRNA levels of Cytokines and appetite gene

The data revealed that LPS decreased the food intake and the bodyweight. In previous reports, the proposed mechanisms of cancer-related and LPS-induced anorexia that may generate pro-inflammatory cytokines like interleukin (IL)-1, tumor-necrosis factor-α (TNF-α), IL-6 and so on (27-32). These cytokines were associated with the induction of anorexia (33). Wong S et al. (29) reported that interleukin-1 beta (IL-1β) appeared dominant in the regulation of feeding behaviour. As previous reports, the mRNA levels of cytokines in the study (Figure 2 A, B, C, D) future verified the predecessors' research.

The CNS in hypothalamus as an action site could suffer some influence from LPS and peripheral cytokines (32, 34). In recent research, two groups are included in the neuronal populations which regulate feeding behaviour. The Agrp and neuropeptide Y (NPY) constitute the orexigenic neuronal group. The other group (POMC/CART) is responsible for decreasing food intake and increasing energy expenditure (35-38). Valeriy Sergeyev et al.(39) reported that an i.p. LPS injection was sufficient to elicit satiety and caused increases in mRNA levels for the anorexigenic messengers POMC and CART in the arcuate nucleus. Pil-Geum Jang et al. (40) found that intraperitoneal administration of LPS (200 µg/kg) increased hypothalamic POMC mRNA expression at 3 h after intraperitoneal administration. Accumulating evidences reported that hypothalamic peptide levels of NPY were decreased in different models of anorectic tumor-bearing rats (14, 41, 42). Although the POMC mRNA expression (shown in Figure 2 G) in our study have no significant difference when intraperitoneally administrated of LPS (100µg/kg), it has an increasing trend relative to control (saline) (P=0.0537; Figure 2 G). These findings, taken together, suggest that hypothalamic melanocortins cause anorexia and weight loss.

2.2 LPS stimulates Hypothalamic NF-кB and leads FOXO1 out of activity

The role of NF-кB pathway is well known in LPS signalling. We investigate the activity of hypothalamic NF-кB and FOXO1 in LPS-induced mice. It was consistent with previous reports (14, 40) that intraperitoneal administration of LPS activated NF-кB in the hypothalami of mice. Our findings suggest that LPS induced NF-кB into nucleus, increasing transcriptional activity. These findings (40, 43, 44) collectively demonstrate that NF-кB activation in the hypothalamus is essential for anorexia induced by LPS.

In order to explore how NF-кB intervene FOXO1 pathway to decrease food intake, we next investigate the protein expression of FOXO1 in Kunming mice hypothalami. The forkhead box-containing protein of the O subfamily (FoxO)-1 regulates metabolism and cellular differentiation in a PI3K-dependent manner (45). As we all known, FOXO1 proteins have pivotal roles in the transcriptional cascades that control metabolism in liver, muscle, pancreas, brain and adipose tissues (46-50). FOXO1 has not yet been shown to regulate LPS-induced anorexia in hypothalamus. Mutiple lines of evidences indicated that FOXO1 promoted certain cytokines production and knockdown of FoxO1 attenuated the hyper-inflammatory phenotype in peripheral (51-53). However, inhibition or deletion Akt produced increased levels of pro-inflammatory cytokines when stimulated with LPS (54). In contrast to studies in peripheral tissue, our data indicate that LPS stimulates PI3K/AKT signalling, resulting in elevated nuclear export of FOXO1 and amplified levels of phosphorylation FOXO1 in hypothalamus. In this study, we demonstrate that LPS inactivates the FOXO1 at the site of Thr24 and Ser256, which is likely the direct decrease in Agrp expression, leading fewer feeding behaviours. Our study suggests that the role of FOXO1 is likely tissue-specific between peripheral tissue and central nervous system.

2.3 The role of AMPK signalling in LPS-induced mice anorexia hypothalamus

The evolutionarily conserved serine/threonine kinase, AMP-activated protein kinase (AMPK), functions as a 'fuel gauge' to monitor cellular energy status (55, 56) and recently, its roles in appetite regulation and the anti-inflammatory in the hypothalamus have raised more concern (14, 17, 18, 57-59). Eduardo R et al. reported that AMPK activation attenuated cancer anorexia and increased survival in tumor bearing rats. Several studies demonstrate that AMPK activation using AICAR attenuates proinflammatory response in vitro study. The potential role of stimulating AMPK in the hypothalamus of LPS-induced anorexia mice remains unclear. Our data indicates that the anorexia signalling of LPS-induced is through AMPK, down-regulating AMPKThr172phosphorylation. AMPK activation by i.c.v injection AICAR (6µg/µl) failed to increase food intake (Figure 7 A). From phosphorylation levels of related proteins, we found that AMPK activation using AICAR in hypothalamus could not improve impact on kinds of related proteins in LPS-induced anorexia mice the hypothalamus.

Contrary to previous reported that the central pharmacological activation of AMPK by AICAR leads to increased food intake and prolonged survival in anorectic TB rats(14). Our results showed that i.c.v. microinfusion of AICAR at the dose of 6µg/µl (2µl) did not increase food intake in LPS-induced anorectic mice, suggesting that LPS-induced animal anorexia may be independent of the AMPK pathway in hypothalamus. LPS-induced anorexia may be the results of the joint action of various factors. In addition to that, maybe there was difference between rats and mice on the drug tolerance.

2.4 The role of mTOR pathway in LPS-induced mice anorexia hypothalamus

The mTOR, an evolutionary conserved serine-threonine kinase, controls critical aspects of the regulation of cell growth, including transcription, translation initiation and elongation, and cell-cycle progression by sensing changes in energy status (25, 26, 60). In addition, mTOR is central to integrating similar signals to control food intake, and it has now emerged as a detector of hormonal and nutritional signals in the hypothalamus (14, 24, 61). Excited hypothalamic mTOR signaling suppresses food intake, however, hypothalamic mTOR inhibition by i.c.v injection of rapamycin significantly increased the short-term intake of chow in pre-satiated rats (24). Lines of evidences indicate that a number of hormones and cytokines are involving in mTOR signalling and mTOR is the downstream of PI3K/AKT pathways, thus both insulin and leptin induced anorectic can be blocked by the inhibition of PI3K (62-64). Daniela Cota et al. (24) observed that inhibition mTOR using rapamycin greatly attenuated the anorexia and body weight loss induced by leptin. Role of rapamycin in LPS induced mice anorexia remains to be clarified. In the study, we observed that mTOR signalling is enhanced through phosphorylation of mTORSer2448 and p70s6kThr389 in the hypothalamus during the inflammatory process created by LPS treatment, which is consistent with Vale´rie Schaeffer et al.(65) reported in peripheral blood mononuclear cells. Insulin and leptin have long linked to activation of mTOR cascade to the decrease in foodintake, mTOR blockade attenuates anorexia and weight loss induced by insulin and leptin in central nervous system. Given above all information, we proposed whether mTOR abrogation could lead anoretic action of LPS diminished. Conceivably, inhibition of central mTOR blocked the anorectic effect of LPS. In the current experiments, we observed that mTOR pathway inhibition attenuated LPS-induced mRNA overexpression of TNF-α, IL-1α and IL-1β but it had no effect on the LPS-induced IL-6 expression. These results are in accordance with Frank Schmitz et al. (66), who showed that serum TNF-α was suppressed by rapamycin in LPS challenged mice, while IL-6 levels essentially remained unchanged. However, in other cell/tissue types such as monocytes rapamycin exposure did reduce LPS-induced IL-6 release (65), suggesting that the sensitivity of IL-6 production to inhibition of the mTOR pathway is cell/tissue-type and condition-dependent. In our experiment, we found that rapamycin prevented over-expression of IL-1α and IL-1β induced by LPS treatment in the hypothalamus , this finding is consistent with several previous in vivo observations. For example, James Harris et al. (67) demonstrated that rapamycin inhibited IL-1β secretion by bone marrow derived cells treated with LPS. Kayo MAEDA et al. (68) showed that rapamycin significantly attenuated the mRNA expression of IL-1β in vehicle-treated myosin-immunized rats.

Besides that, we investigated the mRNA expression of appetite genes, the results showed that rapamycin blocked the increase in POMC and promoted the ratio of NPY/Agrp. The results were in agreement with Eduardo R. Ropelle et al. (14) who indicated that rapamycin attenuated the decrease in NPY and the increase in POMC caused by leucine.

The study shows that LPS is associated with decreased AMPK and increased mTOR activity, which results in a reduction in food intake and weight loss in mice. We detected the phosphorylation levels of AMPK and mTOR and our data suggests that rapamycin activates AMPK signalling and directly inactivates mTOR pathway in LPS induced anorectic mice hypothalami, suggesting that LPS-induced anorexia is dependent on mTOR pathway in a dose-dependent way.

In order to investigate the mechanism of rapamycin attenuate LPS-induced anorexia, we determine the poho-FOXO1 on site of Thr24 and Ser256. From our results, we can demonstrate that rapamyin alleviates the phosphorylation level of FOXO1, suggesting that mTOR block the transcription action of FOXO1 on Agrp and NPY. Once mTOR is inhibited, the transcription of Agrp and NPY is increased, producing more feeding behaviours. Thus, inactivation of the mTOR pathway could increase Agrp and NPY transcription by activating Foxo1 activity, while inhibiting STAT3-mediated Pomc transcription by increasing Foxo1 antagonism of STAT3. Apparently, rapamycin also causes lower phosphorylation level of NF-кB, attenuating inflammatory response in LPS-induced anorexia mice hypothalami. The mechanism(s) whereby LPS regulates Foxo1 to induce anorexia in hypothalamus may be complicated, and future studies will be needed for a complete understanding of these interactions.