This dissertation has been submitted by a student. This is not an example of the work written by our professional dissertation writers.

Historia da minha vida

Pelo dia 31 de Maio de 1983, após 9 meses na barriga da minha mãe já todos me esperavam, principalmente meus pais Luísa da Silva Alves e José Luís Ribeiro da Costa e também minha irmã Liliana Sofia da Silva Ribeiro, mais velha que eu 6 anos. Então lá nasci eu como o previsto de cesariana tal como minha irmã, pesava para cima de 3 quilos e estava perfeitamente saudável, os meus pais registaram-me como Bruno Filipe Alves da Costa no registo civil de Braga, natural da freguesia de Morreira.

Fonte: www.jgmorreira.com

Para onde fui viver com a minha família numa casa modesta mas muito acolhedora, meu pai trabalhava na construção civil e minha mãe era doméstica, a Lili como sempre tratei a minha irmã ia iniciar(-se n) a vida escolar. A minha infância foi feliz pois sempre tive a minha mãe a tempo inteiro para cuidar de mim, nunca me faltou nada apesar das dificuldades, principalmente a comida e os brinquedos com que me divertia imenso.

Aos 6 anos coube-me a mim, iniciar a vida escolar com a entrada na escola primária da Morreira, como todos não conseguia conter o medo do primeiro dia de aulas, que depressa se dissipou quando começamos a conhecer a nossa língua, os números e os nossos novos amigos e companheiros de brincadeira que ainda hoje encontro constantemente, seja no café, no futebol, etc.

Fonte: www.meionorte.com

São amigos de uma vida que começaram no auge da minha infância, porque colegas já tive e tenho muitos mas amizades sérias ao ponto de confiarmos nessas pessoas para contar os nossos segredos, problemas, nossos sucessos são poucos e aí esta a diferença entre um colega e um amigo, por experiencia própria, os colegas que muitas das vezes pensamos erradamente ser nossos amigos acabam por nos desiludir com mentiras e consequentemente quebra de confiança, eu acho que amigos a sério além dos meus pais, irmãos, esposa são poucos, talvez até dê para contar pelos dedos das mãos, mas colegas são inúmeros os que conhecemos quer seja na escola, trabalho, etc, são pessoas com quem nos relacionamos bem mas que por vezes não nos inspiram verdadeiramente confiança para os reconhecermos como amigos, mas não é por isso que deixo de ser solidário para com eles, muitas das vezes as amizades começam perante dificuldades que se passam com alguém que conheço ou comigo, é ai que muitas das vezes se começa a semear grandes amizades, pois os amigos são para todas as ocasiões, sejam elas boas ou más.

Mas é na minha família mais directa que me acompanhou desde a nascença que se escondem os meus amigos privilegiados, aqueles com quem vou ter quando me encontro feliz, triste ou com problemas. É por isso que um ambiente familiar saudável e feliz seja fundamental para também sermos felizes.

Na primária eram inúmeras as novas experiencias, os livros o nosso 1º material escolar, etc. Não foi com grande dificuldade que passei consecutivamente até ao 4ºano de escolaridade, a vida familiar era sólida e feliz e sempre passei bastante tempo com eles, nessa altura a convite de meu padrinho viajamos ate França (Paris), a minha 1ª grande viagem e experiencia de viajar de avião pois era bastante o medo porque sempre tive medo de alturas, mas valeu a pena fui conhecer 1 cidade magnifica que tem historia em qualquer recanto, simplesmente sublime.

Volvido a Portugal já com menos receio do avião, normalmente regressei a vida escolar e social com os meus amigos, os meus passatempos preferidos eram jogar futebol, jogos, andar de bicicleta, ver televisão e as minhas grandes paixões cinema e música.

Voltei para escola para o 5ºano (telescola na altura) e foi um leque de novas coisas que descobri, mais disciplinas com muitos novos temas para abordar, o primeiro contacto com a disciplina de língua estrangeira (francês) língua que acho 1 pouco desinteressante, os primeiros testes para avaliação, mas sem dificuldade passaram mais 2 anos e conclui o 6ºano. Tinha agora 11 anos e começava a ter contacto com novas coisas como os cd´s de música e os seus respectivos leitores, começava a esbater-se a era dos discos de vinil e cassetes áudio, era a evolução da tecnologia que nunca pára!

Ver imagem em tamanho real

Passadas as férias voltei a escola mas não a mesma, ingressei na escola EB2,3 de nogueira que ficava a cerca de 6 km de casa, comecei a utilizar os transportes públicos para me deslocar, e entrei para o 7ºano e ai então as mudanças acentuaram-se muito mais, passei de 1 escola com no máximo 40 alunos (e passei) para outra com cerca de 900 alunos, novas disciplinas, novos colegas, novos métodos de ensino e o primeiro contacto com o computador que ainda eram raros na altura, passei também consecutivamente ate ao 9ºano, por esta altura também já tinha viajado a Alemanha - Freiburg - outra nova cultura muito organizada e eficaz mas com 1 linguagem nada fácil.

A 19 de Março de 1998 fui atropelado e tive de estar internado num hospital público, porque tive uma fractura exposta da tíbia e tive de ser operado, mas aí fui bem tratado e não tenho queixa do hospital público, mas por outra vezes, algumas historias são bem diferentes, um dia, a jogar futebol com os amigos fiz um entorse grave e tive de recorrer as urgências do hospital público, mas quando lá cheguei não havia nenhum ortopedista de serviço, tive de esperar na sala de espera, cheio de dores e com o pé bastante lesionado, cerca de seis horas para que este entrasse ao serviço, e outras vezes que vamos lá com um problema e somos medicados para outro, etc. Mas não são os hospitais públicos que tem culpa, o problema por vezes é de alguns médicos e por vezes enfermeiros, quanto aos médicos se recorrermos a um hospital privado somos tratados de maneira muito diferente porque ai talvez esse médico tenha mais incentivos, mais meios e melhores condições, até há certo tipo de exames e tratamentos que são mais fáceis de fazer num hospital privado, e acabam por ser os cidadãos comuns a arcar com as consequências.

E quase como se recorrermos ao mesmo médico num hospital público e depois ir ao seu consultório as diferenças são bastantes pois ai o médico trabalha para o prestígio do seu consultório e somos muito mais bem tratados, quanto a isto acho que o nosso Governo deveria intervir e mudar algumas coisas, por exemplo acabar com a diferenciação de hospitais públicos e privados, onde as pessoas fossem livres de escolher sem ter de pagar o excesso, mas nem todos são iguais porque grande parte dos médicos tem a noção de ser responsáveis e tratarem bem as pessoas tanto no público como privado. Mas as diferenças ainda são muitas entre as instituições públicas e privadas.

No meu dia-a-dia, tenho o cuidado de fazer o possível para manter o meu corpo saudável, porque nos temos uma palavra a dizer na nossa saúde, e para isso temos de ter cuidados com a alimentação, saber comer o que faz bem, como os vegetais,

Fonte:www.ebicuba.drealentejo.pt frutas e cereais e comer em pouca quantidade do que nos faz mais mal como as carnes, principalmente se forem gordas, os produtos a base de gorduras como manteigas, óleos e acima de tudo os açucares em excesso. Eu tenho de ter cuidados especiais devido a ter desde muito cedo a tensão arterial alta, pois já sou medicado desde os 18 anos para este problema.

Cada povo normalmente tem diferentes hábitos alimentares, uns mais saudáveis mas outros nem por isso, nós em Portugal até temos uma boa dieta, a mediterrânica que das melhores do mundo, é rica em fruta, vegetais, cereais, peixe e legumes secos - tradicionalmente seguida nos países mediterrânicos - está agora a ser defendida pelos nutricionistas mundiais. Este tipo de regime alimentar, além de promover a saúde, funciona como medida terapêutica em doentes com problemas coronários e principalmente na sua prevenção. Em Portugal, calcula-se que apenas um terço da população mantém ainda estes saudáveis hábitos alimentares, porque com o tempo e entrada de novas culturas no nosso país os nossos hábitos alimentares começaram a mudar para outro tipo de comida muito mais calórico e pouco saudável, segundo estudos recentes, mais de metade da população portuguesa (53%) tem excesso de peso e muitos são os que já sofrem de obesidade mórbida que os obriga a colocar “bandas gástricas” no estômago para não comerem demais e poderem ter alguma mobilidade ou qualidade de vida no seu dia-a-dia. Tudo isto porque as pessoas vivem para comer, em vez de comer para viver...Depois recorrem a dietas forçadas, fazendo sacrifícios, às vezes com riscos graves da própria saúde que podem levar à morte ou a sequelas para a vida inteira, como já tem acontecido. Recordo o caso de várias mulheres que tomaram medicamentos receitados numa determinada farmácia que as levou a sentirem-se mal e foram internadas no Hospital, tendo mesmo duas ou três entrado em coma, havendo sobre isso um processo em Tribunal. O governo parece estar agora um pouco mais preocupado com o que se passa no país, em especial sobre a questão da obesidade infantil que é preocupante, incrementando nas cantinas escolares uma dieta mais saudável onde entrem os legumes, os cozidos e grelhados, saladas e frutas, aconselhando actividades nos recreios como havia antigamente (como jogar à bola, correr, saltar, etc.) e não ficarem em casa muito tempo paradas sentadas frente aos computadores. E depois da entrada da fast food, apelidada comida de plástico, a tarefa de melhorar os hábitos alimentares torna-se mais difícil.

Hoje em dia não há razão para isso, já que temos diversos tipos de informação ao nosso dispor, por exemplo na televisão são inúmeras as vezes que passam informação sobre saúde e hábitos alimentares, onde nos dão sugestões que devemos ter sempre em conta, já que são dadas por profissionais de saúde.

Mas não é só na alimentação que devemos ter cuidado, também devemos ocuparmo-nos com exercícios físicos, como andar a pé, correr, andar de bicicleta, frequentar um ginásio, etc., há muitas formas de fazermos exercício nem que seja muitas das vezes se não tivermos tempo, evitar os elevadores e subir pelas escadas, não utilizar transportes para deslocações pequenas, etc. Pois o exercício também e fundamental para um corpo e mente saudáveis, neste momento não estou a praticar nenhum exercício, só o que sou submetido durante o trabalho, que por vezes não e pouco, lá nisso trabalhar na construção é uma mais-valia, pois é uma profissão que exige bastante mobilidade, o que já não acontece com quem trabalha em escritórios, etc. Mas não é por essa razão que não estou a praticar assiduamente exercício, actualmente é complicado devido a ter pouco tempo, mas quando tenho oportunidade faço-o com bastante prazer, até porque durante vários anos pratiquei futebol com amigos todas as semanas e também frequentava o ginásio, e não foram poucas as vezes que incentivei amigos e familiares a participar comigo nestas actividades, lembro-me de muitas vezes quando era preciso alguém para preencher algum lugar na equipa, incentivar os meus amigos a vir, referindo os benefícios que teriam para além do convívio e até porque normalmente sentimo-nos melhor a praticar exercício com gente conhecida.

Também frequentei um ginásio por bastante tempo, onde sociabilizava bastante com os colegas de treino e com os professores, é uma maneira bastante saudável de praticar exercício, ao mesmo tempo que fazemos bem a saúde, fazemos novos colegas e amizades e melhoramos também o nosso estado psicológico e intelectual com novas aprendizagens.

Mas também temos de ver que muitas das vezes determinadas pessoas não devem praticar certos tipos de desportos devido a sua condição de saúde, idade, para estas pessoas deve haver um aconselhamento profissional sobre o que poderá ou não fazer, para que não esteja a praticar algo que seja desajustado ao seu estado físico e assim evitar problemas de saúde, e também há que dizer que o exercício e bom, mas não deve ser praticado em excesso porque daí também podem advir consequências negativas.

Pois eu devido ao acidente que tive, fui privado de fazer exercício durante algum tempo e consequentemente também chumbei pela 1ªvez, voltei á escola no ano lectivo seguinte e aí então concluí o 9ºano, em 1999 ano em que resolvi sair da escola e começar a trabalhar, talvez para me tornar mais independente, os meus pais queriam que eu continuasse os estudos, porque sempre fui 1 aluno com desempenho razoável.

O meu 1ºtrabalho foi com o meu pai na construção civil, sector muito actual, devido ao desemprego, precariedade de trabalho, falta de incentivos ás empresas empregadoras, etc. Identifico vários tipos de matérias, muitos dos direitos laborais não se encaixam no mercado de trabalho porque muitas das faladas grandes empresas nacionais não as respeitam, eu como exemplo que trabalhei bastante tempo na construção civil identifico muitas situações em que os deveres dos trabalhadores são compridos mas já os deveres dos empregadores não o são de todo, no trabalho temos o dever de cumprir os horários estipulados, respeitar os colegas de trabalho como os patrões e encarregados, informar o empregador quando algo nos incomoda em termos laborais, encarregarmo-nos de desempenhar as nossas tarefas de acordo como o exigido, etc. Mas também há os direitos como ser respeitado tanto pelos colegas como meus superiores, direito a ter condições favoráveis ao trabalho tal como higiene e segurança no trabalho, que na construção civil se respeitam muito pouco, carga horária nunca superior ao estipulado por lei, salário compatível com as funções desempenhadas, etc.

Estas empresas normalmente são bastante organizadas, e para observar isso, basta consultar o tipo de documentação e linguagem muito formal que neles utilizam, como nas actas convocatórias e de reuniões, que tem formalidades a ser seguidas:

1º - O dia, lugar e hora da reunião; - Informação se a reunião corresponde à 1.ª ou 2.ª convocatória (normalmente esta informação só se faculta quando a reunião se realiza em 2.ª convocatória); - Forma de convocação.

2º - Mencionar a ordem de trabalhos.

3º - O nome do presidente e, se os houver, do secretário e relator; - O nome dos presentes ou representados (ou, mencionar a existência de uma lista de presenças assinada por todos), Verificação dos condicionalismos constitutivos (quórum, legalidade convocatória, analisar procurações, relatórios e outros documentos).

4º - O teor das deliberações tomadas relativamente à ordem e respectivas propostas apresentadas.

5º- Indicação dos assuntos discutidos que não incluídos na ordem de trabalhos (pedir orçamentos, etc.)

6º-Termo de encerramento.

7º - Anexos (convocatória, lista de presenças, procurações, documentos apresentados, etc.); - Assinaturas (letra e assinatura).

Rodapé: Número da folha e folhas totais (folha 1/2).

Para organização da empresa existe um organograma interno da distribuição de funções, desde a chefia aos operários, exemplo:

É muito importante esta organização, porque uma empresa organizada terá muito melhor desempenho profissional. Para efectuar os pagamentos, a informação passara por vários órgãos aqui representados, até chegar aos operários, um ordenado normalmente é constituído por vários critérios:

Que critérios são esses que fazem variar o valor final a receber?

* Uma empresa pode optar por fazer o processamento de vencimento a 22 dias úteis ou a 30 dias de calendário;

* Pode também optar por processar o subsídio de alimentação a 22 dias fixos, ou a dias úteis efectivos naquele mês;

* Pode processar o subsídio de férias para cada funcionário, individualmente, no período em que ele tira a maior parte das suas férias, ou pode processar para toda a empresa no mês de Junho ou Julho, consoante a maior parte dos seus funcionários gozam as suas férias.

Claro que ainda existem os critérios fiscais de descontos, que ao nível de IRS uma pessoa solteira tem um tratamento diferente duma casada, com filhos de outra sem filhos, com alguma deficiência ou sem deficiência, se vive em Portugal continental ou nas ilhas, ou se pensarmos nos descontos para a segurança social, já temos que entrar em consideração se o trabalhador faz ou não parte dos órgãos, social, etc.

Nesta abordagem inicial sobre o processamento de salários tem que ficar claro que existem várias variáveis que se interligam, sendo essas variáveis oriundas da legislação laboral, da legislação fiscal, da legislação da segurança social, das políticas de processamento de salários adoptadas por cada empresa e dos contratos colectivos de cada actividade.

Por exemplo a fórmula do IRS, embora complicada, toma essencialmente a seguinte forma: Rendimento bruto de cada categoria - as deduções específicas de cada categoria que irão dar o rendimento global liquido. A este subtraem-se os abatimentos, resultando assim o rendimento colectável. Desse resultado divide-se por 1 (se for solteiro) ou por 2 (se for casado) obtendo-se assim o rendimento colectável corrigido. Este resultado multiplicar-se-á por uma determinada taxa de imposto (consoante o rendimento colectável), reduzindo-se então para um determinado valor (parcela a abater), obtendo-se assim um apuramento do imposto. Multiplica-se por 1 ou 2 (consoante o estado civil) resultando a colecta total. Abatem-se as deduções à colecta (determinadas despesas) resultando o imposto liquidado ao qual se irá subtrair o IRS (retenção na fonte ou pagamento por conta).

Esta fórmula irá dar um resultado negativo ou positivo. Se for positivo o contribuinte deverá pagar essa quantia ao Estado; se for negativo será reembolsado pelo Estado. No entanto, no caso de quantias pequenas, o Estado poderá não reembolsar ou exigir o pagamento.

Hoje em dia também temos vários tipos de trabalhadores, o generalista que é capaz de desempenhar varias funções, e o trabalhador específico que se dedica especialmente a um número restrito de funções, como as linhas de montagem.

A linha de montagem foi fundada por Henry Ford inicialmente para a fabricação dos automóveis Ford no ano de 1913 sendo desde essa data considera uma das maiores inovações tecnológicas da era industrial, pois graças a ela, o tempo de produção de peças sofreu um decréscimo significativo, permitindo dessa maneira que se produzisse em maiores quantidades o que mais tarde acabou por se reflectir no preço dos produtos, tornando assim os mesmos mais acessíveis a outras classes sociais.

E veio valorizar muito o trabalho de equipa que permite lidar com novos desafios, contribui para uma maior eficácia da organização, visa sempre atingir determinados fins, o que lhe dá novos conhecimentos, faculta um enriquecimento pessoal através da troca de ideias, distribui a responsabilidade por todos os membros da equipa, fomenta o espírito de entreajuda porque acabam por se gerar relações de confiança e flexibilidade e desenvolvimento de objectivos e expectativas.

As linhas de montagens são utilizadas desde então no processo de produção em série, para que o produto em fabricação seja deslocado ao longo de postos de trabalho, mas a sua eficiência depende da combinação de quatro condições indispensáveis:

* Componentes estandardizados

* Movimento mecânico

* Equipamento de precisão

* Processos estandardizados

A linha de montagem:

* Ajuda a aumentar a eficiência do processo de produção em série, pois permite que cada trabalhador se especialize em desempenhar uma etapa específica do processo de produção

* Implica a existência tempos de ciclos curtos

* É um elemento fundamental em sistemas produtivos orientados para a produção em série

* Representa o culminar de séculos de trabalho

* Refere-se a uma montagem sequencial ligada por mecanismos de movimentação de materiais

* Torna desnecessária a movimentação do operador

Esta grande evolução veio fazer com que as empresas adoptassem o número de trabalhadores mais adequado.

Mas esta evolução também trouxe as empresas o desenvolvimento das tecnologias de informação e comunicação, que em tudo vieram facilitar a sua actividade, desde os telemóveis que permitem contactar toda a gente em praticamente todo o lado, os faxes que permitem o envio e recepção de documentos importantes em instantes, os computadores que permitem reuniões em vídeo conferencia, trabalhar directamente com os bancos e mais facilidade de processamento de documentos, etc.

Não podemos esquecer o factor tempo que é um dos mais importantes actualmente, como a expressão mundialmente conhecida « Time is money », este factor não pode ser esquecido.

O tempo e a sua medição já existem desde há séculos atrás, passando por vários meios e formas, pelas ampulhetas, relógios de sol, relógios de pêndulo, relógios de cristais de quartzo e os mais precisos relógios atómicos que como o seu nome sugere e baseado na propriedade de um átomo, sendo o padrão a frequência de oscilação da sua energia, como um pendo de relógio o átomo é estimulado por ondas electromagnéticas, os elementos mais utilizados nestes são o hidrogénio, rubídio e césio.

Tudo isto mostra como se tornou importante a medição do tempo e a sua aplicação no meio industrial, com a revolução industrial e o desenvolvimento de novos processos industriais que vieram substituir muitos processos artesanais, o tempo de produção diminui muito, sendo possível produzir muito mais em menos tempo, sendo assim também reduzir custos de fabrico como custos ao consumidor, porque com o aumento de produção e concorrência, as empresas diminuem os custos de transformação e consequentemente o custo do produto ao público em geral, se formos a ver uma peça que a 100 anos demorava um dia a fazer, hoje em dia e feita em minutos ou segundos até.

Gerir eficazmente o tempo e essencial para a produtividade do indivíduo e da empresa, é um processo pessoal que passa pela identificação e eliminação de hábitos incorrectos pelo reforço de práticas eficazes e pelo compromisso de novos comportamentos conducentes ao uso positivo do tempo, uma correcta gestão determina a capacidade produtiva da pessoa e muitas das vezes o seu equilíbrio pessoal na ponte profissional e pessoal.

A falta de tempo na nossa vida profissional é, cada vez mais, um problema. Quantas vezes ouvimos as pessoas dizer, por exemplo, que não têm tempo ou que terão de prolongar o seu trabalho na hora de almoço ou ao fim do dia, e ainda que precisavam que o seu dia tivesse mais umas horas para poder fazer tudo o que queriam.
Não podemos alterar o número de horas que um dia tem, mas podemos interferir na gestão do nosso tempo, rentabilizando o tempo que gastamos, e tornando-nos mais produtivos, obtendo assim maiores ganhos (quer em tempo quer em dinheiro).
Para conseguir uma melhor gestão do tempo, é essencial manter uma agenda. Assinalar as tarefas que vão sendo executas, o tempo despendido na sua realização, e também, de quais as alturas do dia mais produtivas. A intenção é verificar o que foi feito e quanto tempo demorou a sua execução. Pode ser surpreendente descobrir que, inesperadamente, se perde muito tempo com situações como ler o email, esperar por compromissos devido aos atrasos ou realizar tarefas ou actividades solicitadas pelos colegas.

Na vida profissional somos constantemente solicitados para realizar inúmeras tarefas, algumas das quais são pouco importantes, não são da nossa competência, ou poderiam ser desempenhadas por outros indivíduos. O excesso de tarefas pode tornar-se no principal “ladrão” de tempo, que é um bem escasso nos dias de hoje. Para evitar o excesso de tarefas deve-se evitar assumir mais trabalho do que aquele que realmente se pode fazer. Uma boa forma de o fazer é utilizando a assertividade, sabendo dizer não quando é proposta mais uma tarefa num momento em que se está atolado de trabalho. Ao analisar todas as actividades que têm de ser realizadas, deve ser claro que algumas têm prioridade sobre as outras, pelo as tarefas menos prioritárias, como foi acima referido, podem ser adiadas, dispensadas ou delegadas, para que as mais prioritárias sejam correctamente desempenhadas.

E o tempo cada vez se torna mais precioso, por isso hoje em dia existem vários meios implementados para tornar a produção e distribuição de produtos o mais rápido possível, as fábricas tem as linhas de fabricação quase totalmente mecanizadas, depois do produto pronto, entra noutra fase que é a sua distribuição para venda, que hoje em dia e assegurada por vários meios de transporte, carros ligeiros veículos pesados, comboios, barcos e aviões, que tornam a exportação e importação muito mais rápida.

Mas não só na vida profissional o tempo tem grande impacto, pois também na vida pessoal isso sucede, o tempo que dedicamos a nossa vida pessoal cada vez e menos, por isso tentamos rentabiliza-lo da melhor maneira possível, por exemplo nas questões culturais muitas das vezes poupamos tempo sem dar conta, por exemplo quando assistimos a espectáculos em directo ou ate mesmo futebol pela televisão, evitamos a deslocação ao estádio que demoraria mais tempo, pois teríamos de sair com antecedência, e depois no fim do jogo contar com o tempo que ainda iremos precisar para nos deslocarmos de novo ate casa, enquanto que se assistirmos pela televisão gastamos menos tempo e podemos fazer algumas tarefas simultaneamente, claro que uma transmissão em directo não se compara á qualidade de estar no evento ao vivo, mas por vezes torna-se a melhor alternativa, até a nível económico.

Muitas das vezes quando o tempo escasseia, também adaptamos a nossa linguagem para a sua gestão, muitas das vezes para poupar tempo contactamos os colegas de trabalho ou familiares via SMS e muita das vezes a escrita torna-se o mais abreviada possível, tal como acontecia nos antigos telegramas, mas também temos os emails que nos facilitam bastante o contacto e comunicação e a poupança tempo quer no trabalho quer na vida pessoal, mas há formas de escrita que não podem ser substituídas e que nos ocupam mais tempo, por exemplo as actas, temos de utilizar parâmetros obrigatórios e uma linguagem bastante formal, tal como documentos importantes que por vezes temos de redigir para entrega a órgãos governamentais, como as finanças e segurança social, ai não podemos poupar tempo a simplificar muito os textos, já que se exige uma apresentação formal, mas não só em documentos podemos constatar essa diferença.

Nos media também podemos verificar isso, pois na televisão por exemplo existem várias maneiras de articular a nossa língua, consoante o tipo de programas, nos programas de entretimento o contacto com o telespectador e feito de maneira mais informal, onde muitas vezes a linguagem é utilizada de forma humorística para divertimento e lazer, já num debate, telejornal, comunicados do governo reparamos que o tipo de linguagem já não é o mesmo, nem poderia ser porque este tipo de informação exige uma apresentação mais formal e séria, pois normalmente estes servem para divulgação de problemas, noticias reais e sérias.

Mas não só destas inovações as empresas crescem, algumas da construção civil principalmente no Minho, Braga e arredores especificamente, tornou-se um pouco para não dizer muito elitista onde os grandes construtores se juntam em parcerias e negócios muitas das vezes duvidosos e pouco transparentes, exemplo: há uma obra em que todas essas empresas se candidatam orçamentando separadamente tendo quase a certeza que uma delas ganhara, passando esta fase a empresa vencedora entra em consórcio com as restantes onde irão dividir os louros e assim acabam quase sempre por penalizar o pequeno empresário, não é á toa que recentemente se divulgou que em cada dia que passa há uma empresa a cessar funções e não são as tais referidas anteriormente.

Nesta altura o mercado de trabalho está muito mal organizado, muitas das vezes pessoas com formação e compreensão numa certa área são preteridas por outras sem o mesmo nível de conhecimentos e aprendizagem porque simplesmente alguém lhes faculta tal possibilidade «as chamadas cunhas» que deixam pessoas extremamente qualificadas no fundo de desemprego.

Não há seriedade e muitas das vezes vermos pessoas com falta de formação incapazes de fornecer informação precisa as pessoas nos sectores estatais, dito isto acho que é o bastante para ver porque estamos em crise, excesso de trabalhadores na função pública e governo a querer diminuir mas sem saber como, e as fraudes fiscais envolvendo membros do governo, as pessoas que deveriam estar acima de qualquer suspeita.

Mas temos o código de trabalho onde podemos consultar os nossos direitos, que muitas das vezes nos são omissos, temos o direito de ter segurança no emprego, número máximo de horas de trabalho, períodos mínimos de descanso, férias retribuídas, retribuição mínima e pagamento de trabalho suplementar, segurança higiene e saúde no trabalho, direito a não discriminação, etc. Estes são apenas alguns direitos fundamentais para que o trabalhador se sinta protegido, por exemplo eu no meu trabalho nunca tive subsídio de férias ou de natal, mas era um direito que deveria ter contestado, estes direitos foram criados para usufruto do trabalhador e não devemos abdicar deles, mas cumprindo também os nossos deveres, para um bem-estar profissional e social.

As normas que temos de adoptar no que respeita á higiene e segurança no trabalho são varias, temos de usar botas de protecção com biqueira e palmilha em aço e anti-choque, capacete para proteger a cabeça, colete de listas fluorescentes e luvas, no manuseamento de certas máquinas também se têm de utilizar óculos de protecção, auscultadores anti-barulho e máscara para proteger as vias respiratórias de poeiras e odores tóxicos, isto tudo para proteger a nossa saúde, anualmente fazemos exames aos ouvidos, olhos, coração e urina para verificar se estamos aptos para o trabalho e rastreio de possíveis doenças, porque na construção muitas das vezes somos expostos a trabalho pesado, produtos tóxicos por inalação e contacto directo com pele e olhos. E então é neste sentido que geralmente aparecem doenças profissionais, ou seja doenças causadas pela exposição a certos materiais profissionais ou por esforço muscular e consequente lesão muscular ou de natureza óssea e os movimentos repetitivos que muitas das vezes nos levam a ter problemas com as articulações e tendões. Por isso devemos sempre adoptar uma posição de cuidado para com nos próprios e interagir com outros profissionais da área para melhorar e aperfeiçoar técnicas de trabalho no sentido de prevenir acidentes, doenças, etc. É por isso que no nosso contrato de trabalho temos cláusulas para salvaguardar estes problemas como por exemplo: 1 - Os trabalhadores e seus familiares têm direito à reparação dos danos emergentes dos acidentes de trabalho e doenças profissionais nos termos previstos na presente lei e demais legislação regulamentar. 2 - Às doenças profissionais aplicam-se, com as devidas adaptações, as normas relativas aos acidentes de trabalho, sem prejuízo das que só a elas especificamente respeitem.

Devemos também informar ou aconselhar profissionais que estejam no local de trabalho a não utilizar técnicas perigosas para com eles e para com os outros, explicitar-lhes a melhor forma de realizarem o trabalho com o mínimo de risco, por exemplo, os andaimes por vezes estão mal apoiados ou escorados, tenho de alertar essas pessoas que estão a realizar o trabalho em altura que estão a colocar em risco a sua segurança, como a dos trabalhadores que os rodeiam, porque se o andaime cai, pode serem cima de alguém.

Também devemos ler a informação dos produtos que utilizamos para nos prevenirmos de danos á saúde, sabendo identificar os diferentes símbolos.

Por outro lado existem profissões com um curto prazo de actividade, normalmente ligadas a cena cultural, como actores, bailarinos, desportistas, etc. Deveria o estado dar a estas profissões mais ajuda? Eu acho que sim, mas não em termos monetários e sim na reintegração na vida profissional noutras áreas ou mesmo nas mesmas, por exemplo um bom bailarino pode ser um bom professor de bailado, e sim a isto que me refiro por á disposição destas pessoas meios para que estas se motivem a permanecer na mesma área mas com uma nova profissão ou então ter ajuda para aprenderem a trabalhar noutras áreas.

A construção e arquitectura no nosso país têm evoluído bastante com o passar dos anos, seja em termos urbanísticos ou na própria mobilidade social, um dos factores que talvez se encontre mais em foco será a habitação social, devido ao crescente numero de pessoas necessitadas, mais atingidas pela crise financeira e desemprego, este tipo de habitação têm vindo a crescer substancialmente para as famílias com poucos recursos.

As famílias que têm alguns recursos mas não o suficiente para trocar de casa, tenta algumas remodelações para que consigam melhorar o seu alojamento familiar, por exemplo antes de casar, morava com os meus pais e como a casa não era muito grande, tivemos de adaptar esse espaço disponível ao agregado familiar, ou seja como éramos quatro pessoas e tínhamos apenas dois quartos, o dos meus pais e da minha irmã, ouve uma altura em que eu precisava do meu próprio quarto, foi então que decidimos remodelar a sala de estar para um quarto para mim, acho que isto é um bom exemplo como as pessoas por vezes tem de se adaptar aos recursos disponíveis.

Como que também há pessoas que tendo a ausência de escritório e moram em prédios com varandas grandes, pegam nesse espaço e fecham-no muitas das vezes em caixilharia e vidro para ai ganharem espaço para um escritório ou muitas das vezes até para tornar uma cozinha maior e mais ampla, consoante as necessidades.

E hoje em dia para quem têm casas mais antigas existem vários tipos de tecnologias para as melhorar, seja em termos por exemplo de isolamento que conta com várias técnicas para proteger o interior das casas de extremos, ou seja calor a mais e muito frio, mantendo assim uma temperatura agradável, estas técnicas até acabam por resolver outros tipos de problemas ao mesmo tempo, como proteger o interior dos barulhos do exterior e proteger possíveis focos de humidade, muitas casas agora também estão a adoptar na sua estrutura vigas e pilares em aço, umas por necessidade de consolidação das estruturas outras para as melhorar e proteger de eventuais fenómenos da natureza, como os sismos, está provado que uma estrutura em aço em caso de sismo será mais resistente, porque o aço e bastante mais flexível que o betão por exemplo, sendo mais flexível em caso de oscilação minimizara os possíveis danos estruturais.

Hoje em dia, a construção de uma casa ou prédio, precisa de cálculos minuciosos para determinar as condições de estabilidade e resistência das estruturas, por isso desde o inicio onde se faz o projecto do edifício, também se faz um projecto sobre pilares, fundações, vigas como um projecto com as estruturas em ferro que irão ser ramificadas nos mesmos junto com o betão, que se chama betão armado, pois o betão por mais resistente que seja sem o ferro seria muito frágil com a oscilação, pois o ferro e parte importante porque vai sustentar o betão e permitir flexibilidade da estrutura.

No projecto também se prevê o esforço que a estrutura ira suportar em termos de peso depois de acabada, então ai trabalha-se com o número de pilares e vigas de suporte as placas bem como a sua espessura para que a estrutura tenha o menos esforço possível.

Pois eu já tive oportunidade de trabalhar numas vivendas geminadas onde o projecto foi mal calculado e as placas acabaram por ceder, devido á estrutura ter sido construída com um betão muito fraco e deveria ter mais pontos de suporte.

Desde do inicio do projecto que se deve planear devidamente as divisões habitacionais para uma maior qualidade de vida e isso significa criar áreas apropriadas ao lazer e sociabilidade, por exemplo criar uma sala de estar maior onde o agregado familiar e convidados se sintam á vontade, um jardim para proporcionar actividades ao ar livre, etc.

Hoje em dia a arquitectura moderna caminha neste sentido de tornar as casas cada vez mais funcionais, não como antigamente que se ligava mais ao aspecto exterior, tornando muitas das vezes as habitações pouco funcionais em termos de lazer.

Existem vários termos técnicos ligados a esta área desde as cotas que são os pontos que determinam a área de construção, pé direito que é a altura do chão ao tecto que normalmente nas habitações é 2,70cm e nas áreas comerciais 3,00cm, os alçados da construção que são as chamadas fachadas exteriores, temos também a área coberta que significa que é a área habitacional, e área total que inclui tudo desde a área coberta, jardim, passeios, etc.

Já tive uma situação onde eu e o meu pai, construímos um anexo na nossa casa e ai como éramos nos que lidávamos directamente com os fornecedores de materiais a linguagem mais técnica de construção era mais utilizada, tanto para com os materiais como a laje, onde tínhamos de calcular a sua área e espessura para o processamento de betão, como o espaçamento entre vigas para saber quantas eram precisas e o comprimento de cada uma já que a área da placa não era quadrada, depois também tivemos de pensar no ferro que seria tecido para reforçar pilares e vigas mestras como a sua espessura também.

Também tivemos de calcular de acordo com a zona o descaimento que o telhado iria ter para que não houvesse futuras infiltrações de água das chuvas, depois veio a parte de acabamentos onde era preciso chapiscar, serezitar, rebocar, etc.

Aí tínhamos de calcular correctamente as áreas para encomendar material adequado para isolamento e enchimento e acabamento.

Todas as obras devem estar devidamente vedadas e conter na nua entrada informações sobre as obrigações, proibições e perigos. Para o efeito existem sinais como o de proibição de entrada de estranhos na obra, perigo de cargas suspensas, a obrigatoriedade de uso de capacete e botas, etc.

Foi neste sector também que conheci os meus primeiros companheiros de trabalho, onde haveria de fazer algumas amizades, pois no meio profissional acaba por haver uma grande entre ajuda entre os funcionários, e foi neste contexto que já conheci e trabalhei com pessoas de outras nacionalidades nesta área, recordo-me de um caso em especial, um individuo romeno que conhecia pelo nome de Doro, era um óptimo companheiro de trabalho, sempre alegre e bem disposto e um bom funcionário, ele emigrou para cá á procura de trabalho para poder dar melhores condições de vida a sua família na Roménia, devido a diferença monetária entre os países, ele já tinha dinheiro para começar uma casa para si no seu país, não tenho nada a dizer dele, a não ser que era um bom profissional, mas muitas das vezes o problema era a língua, mas onde nos entendíamos, ou por outras línguas ou por gestos, nunca descriminei as pessoas que vem para Portugal trabalhar, desde que cumpram com os seus deveres para connosco e para com as instituições que tutelam o sector laboral e social. Porque sendo assim estão a contribuir activamente na nossa sociedade, e muitas das vezes estas pessoas vem dos seus países com cursos superiores, mas não tem medo do trabalho, seja ele qual for, já aqui em Portugal e bem diferente as pessoas querem antes o fundo de desemprego do que se sujeitarem a um trabalho mais duro. É uma experiencia bastante enriquecedora trabalhar com outro tipo de culturas, mas nem todas.

Porque eu tenho um certo preconceito sobre a população cigana, e sei que existe o estereótipo na sociedade portuguesa sobre este povo, por não serem muito sociáveis com outra raça ou etnia, mas não quer dizer que todos sejam iguais, mas que grande parte desta parte de população dedica-se a negócios ilícitos e que pouco contribuem para a sociedade portuguesa, sim é verdade. Eles vivem num mundo a parte e muitas das vezes acham-se acima da lei, vivendo entre nós mas não como nós, há deveres e direitos a ser cumpridos por todos nós, mas para eles isso e relativo, não cumprem por exemplo com os deveres institucionais como o pagamento a segurança social, mas vão lá pedir subsídios e casa novas onde nem sequer chegam a pagar renda.

Grande parte do trabalho desta etnia é a venda de produtos ilícitos como a droga, roupa contrafeita, cópias de cd´s e dvd´s, imitações de perfumes de marca já para não falar de burlas e furtos, mas não são os únicos também há portugueses a cometer estes actos, mas a etnia cigana é muito unida e muitas das vezes ajudam os seus sabendo que não têm razão.

Como exemplo do meu preconceito contra os ciganos, há alguns anos um cigano embateu contra o carro do meu pai, e era totalmente culpado do acidente, mas na sua arrogância não assumia o que fez e os prejuízos que dai advinham, também não tinha seguro automóvel, inspecção muito menos e o meu pai nada podia fazer, ate que o dito cigano resolveu entrar em acordo de pagar o concerto, assim com grandes dificuldades o meu pai lá arranjou o carro, mas não se livrou do dito cigano que passado uns dias foi ameaça-lo ao local de trabalho com uma arma de fogo, como e possível tais pessoas ter tais comportamentos nesta nossa sociedade, será que há maneira de os corrigir e empurra-los para o lado cumpridor da lei, não devendo ajudar mas impor regras a estas pessoas, era bom mas acho um pouco difícil, como disse eles vivem a nossa margem e só interagem connosco para beneficio próprio, muita das vezes ate as forças da autoridade têm medo deles, que iremos fazer quando assim é, nada!

Poderia haver alternativas se talvez houvesse incentivos a estas pessoas, para que se insiram no nosso meio social e económico, mas isso não depende só de nós, também tinha de haver vontade deles, o que acho que não há, talvez nunca mudem devido a sua cultura de se fecharem perante as outras culturas. +++desconstrução do preconceito

Em 2001 tinha 1 situação estável para a minha idade, 18 anos, e já dominava a frente de trabalho em acabamentos, com a aplicação de material de cerâmica, granitos, etc.

Eu já tinha a noção das liberdades e responsabilidades pessoais de certa forma não estão muito díspares entre um e outro, liberdade requer responsabilidade ou o contrario.

Nós temos liberdade para fazermos o que quisermos mas com a consciência da responsabilidade que isso acarreta, somos totalmente responsáveis pelo nosso nível de vida e do agregado familiar e temos a liberdade de decidirmos o que devemos fazer, como nos expressamos, como nos comportamos perante a sociedade, devemos respeitar os outros se queremos ser respeitados por eles, para construirmos nesse sentido uma sociedade consciente de si mesma, liberal mas respeitadora. Temos de ter a consciência livre mas bastante responsável dos actos que realizamos, não podemos ser egoístas e fazermos tudo o que nos da na cabeça sem termos em mente que podemos estar a agir em irresponsabilidade perante os outros cidadãos, temos de saber e conseguir viver em sociedade, e como uma frase popular muito sabia «Não faças aos outros o que não queres que te façam a ti».

Eu tenho carta de condução desde os 18 anos e tive toda a liberdade para a adquirir, passei nos dois exames a 1ª, e desde ai também sei que circular nas estradas repletas por outros carros exige responsabilidade de mim para com os outros.

Agir em liberdade como por exemplo: «Se eu tiver um bem precioso e decido atirar ao mar, em seguida não posso pedir ao mar que mo devolva» por isso acho que a liberdade e a responsabilidade estão muito ligados, quando se pensa em fazer um acto em plena liberdade lembremo-nos da responsabilidade que isso acarreta, para comigo, familiares, amigos, vizinhos e cidadãos em comum!

Eu sou casado e tive toda a liberdade para o fazer mas á partida já sabia que iria ter também bastantes responsabilidades como por exemplo: respeitar a minha esposa, ???? ver ligação criar condutores, como eles por mim o que nem sempre acontece, muitas vezes é falta de civismo, temos a liberdade de conduzir para onde queiramos mas temos que respeitar as leis de trânsito ???, os peões, ter o meu carro apto a circular ou seja com seguro e inspecção, e aí esta a responsabilidade de novo em comum com a liberdade, também quando comprei o meu carro e a minha moto tive a liberdade de o fazer consciente que teria a responsabilidade de pagar as mensalidades dos créditos todos meses até no nosso lar um ambiente estável tanto pessoal como económico, exemplo: pagar as contas ao fim do mês e um acto de responsabilidade de mim perante os outros.

A liberdade e responsabilidade são dois factores fundamentais para o bem comum de uma sociedade. Foi neste âmbito, ser livre nas minhas escolhas, que participei no referendo sobre o aborto, onde votei sim, porque acho que é um problema que já há muito precisava de resolução, devido a tratar-se de um problema de saúde pública grave, já que as mulheres que pretendiam abortar eram encaminhadas para pessoas com pouca consciência e prática médica e condições desumanas, que apenas se interessam apenas pelo dinheiro e não pela saúde de quem as procura, a legalização veio fazer com que este negocio se extingue-se e as mulher que pretendam abortar, sejam livres de o fazer com o melhor acompanhamento médico possível.

Este assunto, que não está isente de polémica, foi pela altura do referendo bastante evocado pelos media e as opiniões de discórdia não tardaram, até dentro da minha família havia diferentes opiniões, que eu respeitava, mesmo que fossem em desacordo da minha. Pois na minha opinião as mulheres devem ser livres de escolher, e mesmo que o aborto não fosse legal, iam continuar a ser feitos em condições desumanas, em que muitas mulheres perderam a vida. Durante as discussões e debates que participei fiz questão de manifestar a minha posição, eu se a minha namorada engravidasse não era capaz de a deixar abortar, mas não sou eu proibir os outros de o fazer, se estão decididos a faze-lo, que o façam em condições que não ponham em risco a saúde física da mulher, já que mental muitas vezes estará já afectada.

Mas é um assunto que estará sempre em discussão, independentemente das decisões tomadas.

Pois comunicação é essencial ao homem e esta traduz-se no facto de ser irrealizável antropologicamente a não comunicação. É que não querer comunicar é já uma forma de comunicação. Neste âmbito acho uma boa medida ter educação sexual nas escolas, porque por um lado estaremos a ensinar os jovens a lidar com os contraceptivos correctamente e a saber os riscos que correm ao não recorrerem a estes, que são muitos, como as doenças sexualmente transmissíveis, um problema que muitos jovens ignoram e por vezes ficam infectados por uma doença para toda a vida, como a sida, basta um momento mal pensado, para muitas das vezes contrair esta doença, talvez a mais grave, mas há muitas mais. A educação sexual também contribui para diminuir a taxa de natalidade na adolescência, que por vezes se torna um problema bastante sério, porque faz com que muitas das vezes os jovens pais abandonem os estudos, para acabarem por se tornar adultos mais cedo, porque sem ajuda o trabalho é indispensável para dar condições favoráveis a essa nova vida.

Mas esta medida também esteve envolta em polémica, principalmente por causa dos pais dos jovens, mas aí muitos pais não têm razão porque se eles dessem a informação necessária aos filhos, não precisavam de aprender na escola.

Eu quanto a isso não tenho queixa dos meus pais, e sempre tive todos os cuidados necessários para evitar tais problemas, e temos que compreender que esta medida e para salvaguardar os jovens e não só.

Entretanto conheci a minha esposa numas férias que fui passar com amigos. Em Agosto de 2002 a convite de amigos fui passar férias na praia e nessas mesmas férias conheci a mulher com quem tive o 1º namoro serio, que haveria de dar casamento!

Continuava a trabalhar com o meu pai, trabalhava com várias máquinas como cortadores de cerâmica, rebarbadoras, misturadores de cola, etc. Onde me deparava com situações por vezes adversas que se passam na minha área de trabalho, de pessoas que se acostumam demasiado e se recusam a aceitar novos métodos de trabalho mesmo que isso lhes vá facilitar a vida profissional, mas temos de ter eticamente a ideia de que temos de mudar, a vida profissional muda constantemente e as pessoas tem de se adaptar a novas praticas de trabalho ao nível profissional organizacional da própria empresa, temos de saber evoluir consoante as ferramentas de trabalho evoluem. Não podemos estar acostumados a mesma função eternamente, o mercado de trabalho tem evoluído muito desde da introdução das novas tecnologias, na minha área de trabalho a processos que passaram a ser bastante mecanizados e temos de nos adaptar e deixar as técnicas que se vão tornando rudimentares e mais lentas hoje em dia. O aparecimento destas novas técnicas veio no inicio complicar a minha vida no trabalho, já que era todo um novo tipo de ferramentas eléctricas e não só que estava a conhecer, mas a adaptação foi rápida e reconheço que facilita muito mais o trabalho e poupa-se tempo o que fez que eu também subisse de nível no trabalho e a ser melhor remunerado profissionalmente, o que contribui bastante para a nossa auto-estima. Veio trazer a outras pessoas reconversões de trabalho e melhoria de carreira profissional em outras áreas.

Mas também temos de evoluir socialmente com moral e ética, já me aconteceu várias vezes no meu trabalho os clientes perguntarem sobre a qualidade de certos materiais, principalmente cerâmicos, e eu respondo com seriedade e sinceridade se o material e bom ou mau ou se vai durar muito tempo ou pouco, acho que esta postura ética só nos faz crescer intelectualmente com nos próprios e para com os outros em prol da sociedade. Mas há empresas que não o fazem, simplesmente se limitam a enganar os clientes e isso é reflexo de má organização estrutural da empresa que não se importa se os seus trabalhadores são eticamente correctos e isso contribui negativamente no mercado de trabalho, e acaba por gerar conflitos profissionais.

Pois nas organizações profissionais nem sempre existe consonância relativamente a interesses, pontos de vista, normas de conduta, o que origina, em muitas situações, conflitos. As partes envolvidas procuram, então, uma saída para a tensão conflitual. Existem vários métodos de lidar com um conflito, mas que perante determinadas situações, revelam-se desajustados e não os resolvem. A compreensão do conflito, a percepção do que está na sua origem e o uso do processo de negociação, como uma forma adaptativa de resolver os múltiplos conflitos interpessoais, promovem a eficácia na prevenção e resolução de conflitos nas organizações.

Compreendendo a importância de uma gestão de conflitos adaptativa nos relacionamentos profissionais.

Para isso muitas das vezes os profissionais recorrem aos sindicatos para mediarem estes conflitos, que normalmente ocorrem entre a entidade patronal e os funcionários, que por vezes se traduzem em greve, ou seja por condições salariais ou laborais.

É muito importante que estes conflitos sejam resolvidos da melhor maneira, se possível com acordo amigável entre as partes, para não criar mal estar nas instituições, tanto eticamente como deontologicamente.

Do grego “ethiké” ou do latim “ethica” (ciência relativa aos costumes), ética é o domínio da filosofia que tem por objectivo o juízo de apreciação que distingue o bem e o mal, o comportamento correcto e o incorrecto. Os princípios éticos constituem-se enquanto directrizes, pelas quais o homem rege o seu comportamento, tendo em vista uma filosofia moral dignificante. Os códigos de ética são dificilmente separáveis da deontologia profissional, pelo que não é pouco frequente os termos ética e deontologia serem utilizados indiferentemente.

O termo Deontologia surge das palavras gregas “déon, déontos” que significa dever e “lógos” que se traduz por discurso ou tratado. Sendo assim, a deontologia seria o tratado do dever ou o conjunto de deveres, princípios e normas adoptadas por um determinado grupo profissional. A deontologia é uma disciplina da ética especial adaptada ao exercício da uma profissão.

Existem inúmeros códigos de deontologia, sendo esta codificação da responsabilidade de associações ou ordens profissionais. Regra geral, os códigos deontológicos têm por base as grandes declarações universais e esforçam-se por traduzir o sentimento ético expresso nestas, adaptando-o, no entanto, às particularidades de cada país e de cada grupo profissional. Para além disso, estes códigos propõem sanções, segundo princípios e procedimentos explícitos, para os infractores do mesmo. Alguns códigos não apresentam funções normativas e vinculativas, oferecendo apenas uma função reguladora. A declaração dos princípios éticos dos psicólogos da Associação dos Psicólogos Portugueses, por exemplo, é exclusivamente um instrumento consultivo. Embora os códigos pretendam oferecer uma reserva moral ou uma garantia de conformidade com os Direitos Humanos, estes podem, por vezes, constituir um perigo de monopolização de uma determinada área ou grupo de questões, relativas a toda a sociedade, por um conjunto de profissionais. No nosso emprego também é muito importante sermos assertivos naquilo que fazemos, temos de ser capazes de elaborar um plano de acção pessoal de maneira a que possamos solucionar situações profissionais complexas, mas para isso temos sempre de procurar evoluir e aprender cada vez mais sobre aquilo em que trabalhamos, seja por formações, que hoje em dia são bastante abundantes, ou com os próprios colegas de trabalho, e muito importante também e a nossa auto-aprendizagem.

Podemos demonstrar a nossa capacidade assertiva de muitas maneiras, uma delas e tentar resolver conflitos no local de trabalho, que em tudo prejudicam o desempenho profissional, por exemplo o conflito entre colegas de trabalho, já muitas vezes me deparei com isso, não e nada saudável para o ambiente profissional, pois os operários com o mal estar acabam por produzir laboralmente menos do que são na realidade capazes, afectando assim a empresa. Por isso é preciso solucionar estes problemas o mais rápido possível e de forma assertiva, temos de procurar a origem do conflito, por exemplo um operário tem melhores condições de trabalho do que outro, isso da origem a conflito, para o podermos solucionar principalmente devemos dialogar com as partes e decidir a melhor solução a dar ao conflito, que acabara por ser a igualdade de direitos nas condições laborais.

Mas para sermos assertivos estaremos em constante aprendizagem.

Para isso entretanto fui frequentando algumas formações no âmbito de melhorar a minha vida tanto a nível pessoal como profissional, em 06 de Setembro a 29 de Novembro com a duração de 44 horas obtive o certificado de formação profissional em secretariado com a classificação de muito bom, na escala de mau a muito bom, tivemos vários formadores para cada âmbito dos módulos dados no total 7, obtive igualmente o certificado de formação profissional em geral de informática com a nota de bom na escala de muito mau a muito bom no período de 09 de Abril de 2005 a 18 de Junho de 2005 com a duração de 45 horas, trabalhado em vários módulos principalmente em Windows xp e Office xp como em ferramentas de internet.

Por esta altura era membro de um movimento na minha freguesia, que era um grupo de jovens virado para a igreja católica e onde aplicávamos vários tipos de actividades, claro que era um grupo mais virado para chamar jovens a participar mais na freguesia mesmo não sendo um grupo institucional virado para a democracia do pais, mas desenvolvíamos vários temas nesse âmbito tanto social como institucional, o nosso maior objectivo foi participar nas jornadas mundiais da juventude em 2005 que se organizaram na Alemanha «Colónia» mas para isso levamos a cabo vários tipos de actividades de conjunto para a angariação de fundos para a viagem, organizamos vários convívios onde os habitantes se podiam manifestar, participar e apoiar, também levantamos uma tradição que consistia em cantar os reis nas casa da freguesia e nas quais fazíamos questão de comunicar para que seriam as contribuições porque não fazia sentido ficar com o dinheiro para beneficio próprio, mas sim para sustentação do grupo de nome Oásis, pertencente ao movimento dos jovens sem fronteiras.

Mas não tínhamos nada de muito comum com os grupos institucionais que tem uma hierarquia, presidente, vice-presidente, secretario, tesoureiro, etc. E que são bastante disciplinados e rígidos quando se reúnem, seja na assembleia da república ou na direcção de um clube de futebol onde elaboram uma acta onde identificam quem esteve presente e sobre o assuntos contidos na reunião, que será lida e assinada pelo presidente e secretario, nestas instituições também existem votações seja para novos candidatos ou para novos projectos e aí também tem o dever de decidir e votar no projecto que mais idealizam.

Já no grupo de jovens tínhamos debates e decisões mas que nada tinha de burocracia, votações era mão no ar e reuniões pouco formais, mais viradas para a juventude e assuntos com ela relacionados. Era mais um grupo para levar os jovens a se reunir por uma causa, um valor ou ate pela amizade que foi gerada que persiste até hoje.

Um dos meus passatempos preferidos é ver televisão mas ultimamente este espaço tem sido invadido por programas pouco ou nada construtivos onde muitas das vezes acabam por influenciar as pessoas, e acabam por criar estereótipos sociais que nada tem a ver com a realidade, por exemplo, os programas em que fazem parecer que as loiras são intelectualmente inferiores, ou que os alentejanos são preguiçosos, etc.

Depois também passaram os chamados reality shows que só tinham audiência pela curiosidade das pessoas em verem como outras pessoas vivem ou como se comportam, muito disto é devido á batalha das audiências e por vezes os nossos canais não ligam a meios para atingir fins, lembro-me de um desses programas que se chamava «A Bela e o Mestre», que consistia porem doze mulheres numa casa onde seguiriam as ordens de um homem, o dito mestre, que acabava por passar para a opinião pública de que um homem e mais inteligente que uma mulher, o que não e verdade, mas os media podem fazer isso, mudar a opinião a muita gente, e além do mais também os noticiários são bastante sensacionalistas, onde as noticias más se repetem quase todos dias, porque as pessoas em geral gostam de tragédia, mas porque, eu acho que talvez seja pelo exagero de tantos anos a passarem estas noticias, muitas das vezes ate certos acontecimentos que se associam a algo de bom, não tem tempo de antena, são simplesmente preteridos por ex: acidentes, catástrofes naturais, etc.

E como principais meios de comunicação de massas, temos os jornais, revistas, televisão, rádio e internet, mas muitas das vezes estes meios são usados para persuadir, confundir e alterar a opinião pública em certos aspectos, o que esta mal, mas isto só revela o poder que estas detêm sobre o público em geral. Por exemplo assistimos muito a isto na nossa política e nos seus interesses, porque estamos acostumados a receber informações diariamente de tudo que se passa ao nosso redor e em todo mundo. Assistimos a notícias, anúncios, filmes, detalhes de actores e celebridades, e assuntos gerais que ocupam o tempo e nos isolam da realidade. Toda essa comunicação nos impõe um padrão de vida e felicidade a ser alcançado, com objectivos e ideais muitas vezes impossíveis para todos, mas diante a televisão isso torna-se possível. A realidade dos telejornais é passada como algo distante e irreal, enquanto as novelas emocionam o país como se fossem problemas reais que afectam a todos ou seja esta inversão entre realidade e ficção é notável principalmente nas novelas assim a novela passa por um relato do real, enquanto o noticiário (que perdeu as referências temporais e espaciais) torna-se irreal. A prova disso são telespectadores que se comovem em demasia com a morte de uma personagem, enquanto um desastre real em algum lugar do mundo passa por ouvintes inertes e insensíveis ao fato. Assim os indivíduos abdicam de sua liberdade pelos meios de comunicação e deixam-se ser controlados. Os principais responsáveis são, o governo e classes socioeconómicas dominantes, tanto financeiramente como culturalmente, utilizando essas médias de modo a manipular a sociedade.

As novas tecnologias também têm um papel preponderante nos media, por exemplo na televisão o satélite tem um papel muito importante quando se trata de recepção e emissão de informação entre locais distantes, proporcionando assim informação em grande escala. O satélite e o funcionamento dum sistema de video por satélite consiste no princípio da repetição, no satélite, dum sinal digital modulado em banda base proveniente duma antena emissora, com uma determinada zona de recepção como destinatária, na qual qualquer receptor de características adequadas poderá captar o sinal, independentemente de se encontrar por trás desta um sistema capaz de o reconstruir e interpretar correctamente, ou não. Este sinal vem sempre sobre a forma duma micro onda, mais especificamente numa banda de utilização pré-definida, conforme a aplicação, mas tipicamente, para vídeo, na banda C (4-8 GHz) ou Ku (12-18 GHz). O satélite encontra-se normalmente numa órbita geoestacionária, portanto mantendo a sua posição relativa em relação à superfície terrestre, encontrando-se assim sempre nas mesmas coordenadas celestes, de resto uma exigência natural para o tipo de função retransmissora que desempenha.

A forma como os dados recebidos são tratados é da responsabilidade dos elementos de suporte ao aparelho receptor, e variam de acordo com a aplicação pretendida. Estes aparelhos são tipicamente nos dias que correm conhecidos por box´s que fazem a ligação entre a antena receptora e o televisor (ou ecrã de computador por exemplo).

A fonte de emissão é o local onde todo o processo se inicia e onde o sinal "cru" provem. A fonte de emissão depende da aplicação pretendida e pode ir desde uma central emissora televisiva, onde os conteúdos são produzidos em estúdio e depois transmitidos e tratados através duma rede local de forma a se adequarem às normas de retransmissão via satélite, a um terminal móvel, onde toda a produção, manipulação e transmissão de dados ocorre num mesmo aparelho.

Nos centros de emissão televisivos, a programação a transmitir é disposta “à saída” do estúdio de gravação sobre a forma dum fluxo digital de alta qualidade, sem compressão. Na era pré-digital este fluxo, era modulado e transmitido desta forma, através do uplink, para o satélite, ocupando na ordem dos 270 Mbit/s de espaço, preenchendo desta forma o canal de transmissão inteiro.

Actualmente, porém, recorrem-se a técnicas de compressão do sinal, ainda no centro/fonte de emissão, para reduzir o tamanho destes fluxos sem perder significativamente qualidade de imagem e som. A multiplexagem, por seu turno, garante uma eficiente gestão de banda ao permitir incluir, numa única onda, várias programações em formato SDTV ou HDTV (dependendo da norma de compressão e o standard utilizado). Estas duas técnicas de tratamento de dados vieram permitir a transmissão de vários canais de conteúdos televisivos num único sinal de banda base, sendo que para correctamente interpretá-lo, o sistema receptor terá que estar adequado à descompressão do sinal segundo as mesmas normas em que foi comprimido/multiplexado.

É este o princípio técnico fundamental por trás, por exemplo, das distribuidoras multi-canal e um factor preponderante para o crescimento e popularização de sistemas de distribuição de conteúdo televisivo sobre as suas mais diversas modalidades, a nível nacional e internacional.

A Comunicação é o intercâmbio de informação entre sujeitos ou objectos. Deste ponto de vista, a comunicação inclui temas técnicos (por exemplo, a telecomunicação), biológicos (por exemplo, fisiologia, função e evolução) e sociais (por exemplo, jornalismo, relações públicas, publicidade, audiovisual e meios de comunicação de massa).

Nas televisões utiliza-se muito o horário nobre (20h/23h) para a divulgação de publicidade importante para as próprias, porque neste horário há mais telespectadores, havendo mais público a publicidade nestas valoriza e torna-se muito cara, e por ser uma das suas principais fontes de rendimento, as televisões usam e abusam da publicidade neste horário, para vender os produtos dos clientes que publicitam aos telespectadores, que muitas das vezes devido ao excesso de publicidade a alguns produtos são inconscientemente induzidos a compra-lo, muitas das vezes os produtos são publicitados nos próprios programas e telenovelas.

É por isso que existem vários estudos, o estudo do comportamento do consumidor adquiriu uma inequívoca autonomia e um novo estatuto no quadro das ciências sociais. Presentemente é uma função nuclear em todos os sectores de actividade. A sua característica transversal a todas as organizações, instituições ou grupos sociais, desde os processos de aprendizagem até a influência cultural e familiar, passando pelos processos cognitivos e de pressão social, coloca no profissional de comunicação estratégica responsabilidades acrescidas, desafiadoras, mas aliciantes. O estudo do comportamento do consumidor é fundamental para o aumento da eficácia de qualquer estratégia de comunicação, seja ela de carácter politico, empresarial e/ou até de qualquer ONG. É efectivamente uma fonte de criação de valor, e também por isso está constantemente sujeita a uma forte pressão de ajustamento, renovação e inovação.

Os media também são importantes na divulgação de bens culturais e artísticos, como jogos de futebol, espectáculos variados como teatro, musica, etc.

Mas existem diversos graus de visibilidade de autores e bens culturais e artísticos nos media, tudo devido ao meio em que são divulgados, claro que um espectáculo de musica na televisão têm muito mais impacto do que se fosse divulgado na rádio por exemplo. Falar de Meios de Comunicação Social (MCS) enquanto elementos de regulação cultural é abarcar num só desígnio uma série de dimensões

tão díspares quanto semelhantes da sociedade. É pelos MCS que se sabe o que se passa no mundo, que se conhecem e visualizam outras culturas, que se sabe o que existe, o que se publica ou que se faz. É também através dos MCS que fruímos cultura, ou pelo menos alguma, independentemente da sua qualidade. Na realidade, cultura e comunicação são dois termos que se interpenetram desde o surgimento dos primeiros meios de comunicação social. Apesar da existência de outros agentes mediadores e transmissores de cultura, como a Educação ou a Família, é inegável o poder que os media exercem sobre um número elevado de indivíduos.

Dentro da comunicação social também existem vários tipos de linguagem associados ao contexto em que estão inseridos, a informação ao púbico nos noticiários e jornais é um bom exemplo de uma linguagem formal e séria, porque está-se a lidar com assuntos verídicos grande parte das vezes, problemáticos e reais e por isso o público tem de ser tratado com a seriedade que estes assuntos exigem.

No que respeita a entretimento, vemos que a linguagem usada é um pouco diferente, mais rotineira e mais fácil compreensão, mas com um propósito, de entreter o espectador sem o saturar por tipos de linguagem formais, agarrando assim mais atenção e predisposição pública, é por isso que nos top´s de programas mais vistos e artigos lidos estão sempre as novelas, reality shows, imprensa cor-de-rosa, etc.

Os media actualmente têm bastante influencia sobre a sociedade, por isso são considerados o quarto poder, com a persuasão, manipulação e formação de opinião pública em vários assuntos, um deles é a politica, pois muitas das vezes somos confrontados com noticias de origem duvidosa com o propósito de alteração de opinião pública, o que é lastimável, mas vai acontecendo bastantes vezes principalmente quando se aproximam actos eleitorais, porquê?

Porque os media não se conseguem manter neutros, muitas das vezes devido a orientação politica dos seus dirigentes, que tentam vender junto a sua informação ideias e ideais muitas das vezes irreais ou destorcidos para sua conveniência, para termos uma ideia, há vários políticos nacionais e internacionais que possuem órgãos de comunicação social, seja canais de televisão, jornais ou revistas.

Será que poderia haver uma legislação que controla-se tais comportamentos, poderia, mas sinceramente tudo iria continuar igual.

Mas só para acabar gostaria de falar sobre o nosso horário nobre televisivo que nada tem de construtivo e informativo, somos simplesmente invadidos no nosso ecrã por um excesso de telenovelas, tanto portuguesas como brasileiras, não estou a dizer que são más, mas são muitas e se uma pessoa quer ver algo com um pouco de cultura temos de esperar até altas horas, mas é a batalha dos canais e eu nada posso fazer para mudar isso, limito-me a desligar o televisor muitas das vezes.

Em 2005 nas últimas eleições integrei a lista do Partido Socialista da minha freguesia a convite de quem viria a ser o actual presidente da Morreira freguesia onde cresci e vivo actualmente.

O meu papel nessa lista era tentar conseguir votos suficientes para ganhar e ser eleito para a assembleia da junta, e participar nos projectos que seriam apresentados aos eleitores, alguns até já foram executados alguns deles, no geral os meus objectivos eram para fazer crescer a minha freguesia em termos de infra-estruturas, principalmente sociais para melhor qualidade de vida dos cidadãos.

Foi uma experiência bastante interessante e motivante pois o que estava a fazer era em prol da minha freguesia, tivemos reuniões de planeamento de projectos a evidenciar na freguesia, até que chegou o dia de apresentação da lista aos habitantes, foi com muita consideração que tivemos presente o também nosso actual presidente da câmara o Sr. Engenheiro Mesquita Machado que muito tem feito por Braga. Volvido pouco tempo chegara o dia da liberdade das nossas escolhas, dia de eleições. Tal como todos os cidadãos com 18 anos ou mais deveriam fazer fui exercer o direito democrático que me assiste, o direito ao voto é um dos direitos mais importantes conquistado pelo nosso País por isso não devemos desperdiçá-lo, pois há quem desperdice e depois opine sobre as decisões governamentais aí essa pessoa deve se arrepender de não ter feito a sua escolha partidária porque várias pessoas assim podiam fazer a diferença. Com as urnas de voto encerradas restou-me esperar pelos resultados e foi com muita alegria que soube que o nosso projecto tinha ganho, não tive votos suficientes para ser eleito mas o gosto da vitória superava tal pensamento foi com agrado que fomos saudados pelo nosso cabeça de lista, que iria suceder ao antigo presidente.

A nossa Constituição da República dá muitos exemplos de direitos e deveres a nível institucional como: direito à vida, direito à integridade pessoal, direito à liberdade e segurança, liberdade de expressão e informação, etc. Tudo isto está feito de maneira a cumprirmos os nossos deveres sem nos esquecermos dos nossos direitos.

Foi neste ano que também iniciei a minha própria empresa na construção civil na área de acabamentos, que viria a manter até 2008, mas com a crise no sector tive de cessar actividade devido a ter saldos negativos com a falta de pagamentos de clientes que ainda hoje me devem e a pouca oferta de trabalho na área também não ajudava. A construção civil acabou por se tornar num sector 1 pouco elitista onde as empresas de grande dimensão dominam e sobrevivem muito a conta de jogos de interesses e negócios muito pouco transparentes e concorrência desleal, e é um sector muito precário onde muitas das vezes a segurança dos operários fica em último lugar.

Mas os processos de inovação na construção civil foram bastantes desde o telemóvel que permite contactar qualquer operário ou cliente em qualquer sitio, passando pelo computador que permitiu que fizesse os planos e orçamentos de trabalho de forma mais rápida mais cómoda e eficiente, também os processos de trabalho de trabalho se tornaram mais rápidos devido ao evoluir das ferramentas e maquinas de trabalho em vários sentidos, quando entrei para construção civil a mistura de colas para cerâmicas era feita manualmente, agora não porque existem misturadores que reduzem significa mente o tempo de preparação, também rebarbadoras passaram a ter dispositivos de segurança anti-bloqueio como os berbequins e martelos demolidores, mas entre estes vários gostaria de destacar os níveis a laser que vieram substituir as antigas mangueiras transparentes com agua para passar níveis de terreno e de chãos, pois o laser diminui para uma área de 80m2 o tempo de tiragem de níveis para menos de metade do tempo, também nas medições houve avanços, as fitas métricas agora são muitas vezes substituídas por medidores de laser ou ultra sons.

A tecnologia, as TIC possibilitaram várias novas formas de trabalhar e reestruturar o trabalho, hoje em dia é indispensável lidarmos com as novas tecnologias no trabalho seja com o telemóvel que se tornou um utensílio bastante utilitário na comunicação no meu trabalho, tanto como o computador que nos permite ter um acesso mais fácil a novos materiais como as vezes novas técnicas de trabalho, já que o computador também permite comunicar muito facilmente, anunciar, fazer pagamentos relacionados com o trabalho ou o contrario, receber via transferências bancárias feitas por qualquer computador empresarial ou pessoal.

Para mim o telemóvel tornou-se indispensável já que e com ele que contacto e sou contactado por futuros clientes, operários, fornecedores de material e os patrões muitas das vezes por questões salariais em atraso.

Mas este aparelho tornou-se também um objecto imprescindível á sociedade em geral devido a sua portabilidade e utilidade pessoal e profissional, o telemóvel devido ainda a sua curta história é bastante mais utilizado pelas novas gerações e pela sociedade em geral até á meia-idade, a população mais idosa acabou por ser a que menos se adaptou a este aparelho, talvez por causa do baixo grau de conhecimento devido a não terem tido a oportunidade de estudar e aprender a lidar com estas tecnologias e a diferença de gerações, mas são muitos os idosos que pretendem aderir as novas tecnologias e tentam aprender, mas ainda são poucos.

Estes equipamentos são bastante complexos e compostos por vários elementos desde as baterias (lítio/ião), antenas que podem ser interiores ou exteriores ao aparelho, os ecrãs que vão desde os primeiros a preto e branco até aos recentes ecrãs de cristais líquidos de varias dimensões e resoluções que podem chegar até 256 milhões de pixéis, os avançados microfones e altifalantes que permitem ter conversas em alta voz e marcação por voz, as utilitárias aplicações de infra-vermelhos e bluetooth que permitem a partilha de ficheiros de uma forma rápida, etc.

Os telemóveis também utilizam vários tipos de redes, desde a GSM, mais antiga que somente permite os telefonemas e envio de mensagens escritas, GPRS que já permite também o envio de mensagens de imagens e o acesso condicionado á internet, e as mais recentes redes de 3G e 3,5G que permitem fazer vídeo chamada, acesso á internet, MSN, hi5, etc.

Um telefone celular ou telemóvel. É um aparelho de comunicação por ondas electromagnéticas que permite a transmissão bidireccional de voz e dados utilizáveis em uma área geográfica que se encontra dividida em células (de onde provêm a nomenclatura celular), cada uma delas servida por um transmissor/receptor. A invenção do telefone celular ocorreu em 1947 pelo laboratório Bell, nos EUA.

Há diferentes tecnologias para a difusão das ondas electromagnéticas nos telefones celulares, baseadas na compressão das informações ou na sua distribuição: na primeira geração (1G) (a analógica, desenvolvida no início dos anos 80), com os sistemas NMT e AMPS; na segunda geração (2G) (digital, desenvolvida no final dos anos 80 e início dos anos 90): GSM, CDMA e TDMA; na segunda geração e meia (2,5G) (uma evolução à 2G, com melhorias significativas em capacidade de transmissão de dados e na adopção da tecnologia de pacotes e não mais comutação de circuitos), presente nas tecnologias GPRS, EDGE, HSCSD e 1xRTT; na terceira geração (3G) (digital, com mais recursos, em desenvolvimento desde o final dos anos 90), com UMTS e cdma2000.

Ou seja o principio de comunicação dos telemóveis e a difusão de células electromagnéticas, que são servidas pelas torres emissoras, retransmissoras e receptoras.

O telemóvel tem também a sua vertente cultural, pois para alem da comunicação de culturas, este hoje em dia permite tirar fotografias, gravar vídeos e fazer a sua partilha, para alem de outras funcionalidades como despertador, agenda que permite uma melhor organização pessoal, lembretes, e o acesso á internet que muitas das vezes já utilizei por exemplo para saber as horas das cessões de cinema e a reserva de bilhetes.

Os telemóveis vieram também alterar certos aspectos linguísticos, como a escrita abreviada que é muito utilizada pelos mais jovens para poupar tempo e espaço, exemplos:

* Tudo bem - td bm

* Que estas a fazer - k fzs

* Beijos - bjs

Ou seja suprimem as vogais para simplificar a escrita, o que não é bom para as futuras gerações. Mas não só por forma abreviada se comunicam, também se utiliza símbolos e imagens, principalmente na comunicação pelo MSN.

Mas a comunicação com as novas tecnologias é uma mais-valia inegável, na aproximação de pessoas e dialogo, quer seja oral ou por escrito, seja por motivos profissionais ou pessoais, estas vieram derrubar muitas fronteiras e com os avanços que estão em desenvolvimento, a comunicação será ainda mais fácil.

Comunicações rádio STC CLC????

No meu trabalho devido a grande quantidade de materiais que existem na construção civil, existe sempre desperdícios dos mesmos e então e necessário proceder a sua separação para enviar para a reciclagem, normalmente na construção o lixo e separado das seguintes formas, plástico, papel e cartão, metal, madeira, vidro e materiais não conformes que se destinam a aterro sanitário já que não são recicláveis, muitas das madeiras têm de ser separadas para serem incineradas, porque libertam substancias tóxicas ao ser queimada, mas a co-incineração ainda é bastante polémica entre nós pelo medo das pessoas que essas substancias tóxicas lhe sejam transmitidas pelo oxigénio, mas actualmente a co-incineração dos resíduos mais perigosos é feita por injecção na zona de queima, o que permite uma destruição com uma eficiência tipicamente superior a 99,99%. O arrefecimento dos gases antes da sua chegada aos filtros permite atingir níveis muito baixos de emissão de dioxinas, independentemente do tipo de combustível usado. A co-incineração feita no respeito das boas práticas industriais é actualmente um processo seguro de valorização de resíduos industriais em fim de linha, praticado há muitos anos em numerosos países europeus. As análises sistemáticas dos efluentes gasosos não se distinguem das encontradas quando são apenas usados os combustíveis tradicionais. Por isso ainda é o sistema mais eficaz e seguro no que respeita a resíduos tóxicos e perigosos.

Também há produtos que podem ser aproveitados para criar energia, por exemplo através da fermentação de matérias orgânicas sejam elas esterco, esgotos e outras matérias biodegradáveis, temos como resultado o metano que é um gás também conhecido por biogás que depois é utilizado ou na indústria ou em casa.

Quanto aos resíduos recicláveis seguem a sua via normal e entram num ciclo que lhes vai dar uma nova forma, por exemplo o processo de reciclagem do vidro é muito simples: basta juntar o vidro velho com uma pequena percentagem de matéria-prima de base ou não, e fundir, para que se obtenha vidro novo. A reciclagem do vidro começa nos consumidores, em vez de se deitarem garrafas vazias no lixo deve deitar-se no vidrão. As câmaras municipais ocupam-se da recolha deste e de o vender às indústrias que o irão reciclar. Desta forma, consome-se menos matéria-prima (para obter uma tonelada de vidro é suficiente uma tonelada de casco, em vez de 1.2t, ou seja uma economia de 20% em peso), poupa-se energia eléctrica (cerca de 32%), água (cerca de 50%), reduz-se as emissões atmosféricas (cerca de 20%) e o volume total de resíduos sólidos a tratar (cerca de 10%).

Mas nada disto era possível sem os profissionais que operam directamente com os lixos, matérias recicláveis. Pois existem os que estão na frente da recolha destes materiais, seja o camião do lixo, ou o camião que vem buscar as matérias previamente seleccionadas e separadas pelo consumidor. Em seguida á recolha entram em campo os profissionais de separação de matérias que posteriormente serão enviadas para locais adequados ao seu tratamento, se forem recicláveis normalmente seguem para a indústria, os não recicláveis normalmente seguem para aterro sanitário onde será tratado por profissionais do sector.

Também não nos podemos esquecer das campanhas e anúncios passados principalmente na televisão, sobre a importância da reciclagem e como a efectuar, inclusive ao separarmos o lixo estamos a ajudar instituições de prevenção e tratamento de doenças como o cancro, este anúncio passa várias vezes no horário nobre para chegar ao maior número de pessoas possível.

Em Portugal a percentagem de vidro reciclado cifra-se nos 30%, podendo o valor aumentar pelo esforço dos cidadãos na participação na deposição selectiva.

Muitos artistas dão asas a imaginação e utilizam matérias recicláveis nos seus trabalhos, desde o vidro ás esculturas com restos de ferragens, o papel que também e muito utilizado por estes cidadãos nas suas obras, além de nos darem um contributo cultural, acabam por ter um papel muito positivo na sociedade com a reutilização destes materiais.++++refectir sobre a competência as suas práticas de reciclagem (ver descrições do DR)

Tudo devido à globalização que veio tornar o nosso mundo um pouco mais pequeno, pois com a abertura dos mercados internacionais, começaram a circular produtos de todo mundo pelo nosso pais, e com a evolução dos transportes este sistema torna-se cada vez mais rápido tanto a importação como exportação, mas não só os produtos começaram a circular mais livremente, também as pessoas passaram a viajar mais, e hoje em dia não há nenhum destino de viagem impossível, e isso também nos trouxe o contacto com novas culturas e novas linguagens, eu por exemplo já tive o prazer de visitar Espanha, França e Alemanha, onde convivemos com novos costumes.

As TIC também têm um papel fundamental nesta aldeia global, que nos ajudou por exemplo no contacto com familiares no estrangeiro, falando em tempo real para qualquer parte do mundo. Mas a verdadeira evolução viria com o computador e a internet que interligou todos os países e veio acelerar processos outrora demorados, hoje em contacto amigos e familiares via Web em tempo real e até podemos ver em tempo real em qualquer parte do mundo.

Com a globalização também foi necessário a criação de órgãos que viessem a actuar mundialmente em varias vertentes como a ONU na tentativa de manutenção de paz mundial e ajuda monetária aos países mais desfavorecidos, como a NATO organização preparada para entrar rapidamente em qualquer cenário hostil e tentar resolve-lo de imediato. Mas existem também muitas pessoas que se dedicam ao voluntariado ajudando em situações de crise vários países, como a UNICEF, Cruz Vermelha, Médicos sem fronteiras para quem muitas das vezes sou convidado a contribuir, e muitas mais.

Eu acho que a globalização foi muito positiva apesar de ter os seus contras, mas estamos a caminhar no sentido de melhorar e aperfeiçoar mais e melhores métodos sociais, tecnológicos, científicos, etc. Que nos farão evoluir cada vez mais e melhor.

Uma das grandes descobertas cientificas, foi sem duvida o ADN, Ácido DesoxirriboNucleico, é uma molécula biológica universal presente em todas as células vivas. É no ADN que está contida toda a nossa informação genética, sob a forma de genes. O ADN é constituído por quatro tipos de nucleótidos , unidade básica do ADN (que por sua vez é constituído por uma pentose, um grupo fosfato e uma base azotada), que se associam de uma forma específica, formando uma cadeia dupla: adenina (A) com timina (T) e guanina (G) com citosina (C). Os nucleótidos são designados deste modo devido às bases azotadas que entram nas suas constituições. É possível ler a cadeia de ADN, obtendo-se uma sequência de letras, como por exemplo, ATGATTCTGTAGCCTGATCCC, a uma sequência completa de ADN dá-se o nome de genoma.

O ADN tem a forma de uma escada de corda enrolada helicoidalmente, ou seja, de uma hélice dupla em que os degraus são formados por pares de bases azotadas ligadas entre si, através de ligações de hidrogénio, com fundamento na complementaridade de bases. A estrutura, do ADN, foi proposta há 53 anos por James Watson e Francis Crick. A descoberta da estrutura do ADN abriu o caminho para se compreender como é que a informação genética é transmitida de progenitores para descendentes, ou de uma célula para outra, isto é, como funciona a hereditariedade.

Hoje em dia, esta descoberta tem um impacto em muitas áreas da vida moderna, tais como a medicina, a reprodução, a alimentação, a longevidade e o ambiente. No caso da medicina, e da saúde, há milhares de doenças hereditárias diferentes: cada uma resulta de um defeito num gene, muitos dos quais agora conhecemos. Assim, sabe-se detectar esses defeitos antes da nascença e tem-se esperança de os poder corrigir dentro de algum tempo, utilizando a terapia génica. Os testes genéticos permitem prever as doenças genéticas a que um indivíduo está mais sujeito e preveni-las a tempo. A amniocentese é um exemplo de um teste genético pré-natal que é muito usado para detectar se um bebé irá sofrer o síndroma de Down, mais conhecido como mongolismo, e que resulta da duplicação do cromossoma 21. Outro exemplo de influência genética é na reprodução, são as técnicas de fertilização in vitro (FIV) que permitem que hoje muitos casais inférteis possam ter filhos. Aliado à FIV está o diagnóstico genético preimplantatório, que permite detectar, nos embriões, erros no ADN que causam doenças, reduzindo-se assim a probabilidade de a criança nascer com uma doença genética. Este diagnóstico não pode, contudo, ser usado para excluir embriões com características estéticas e sociais não desejadas, como por exemplo, cor dos olhos, sexo ou inteligência. No ambiente o ADN é uma importante ferramenta para se salvarem espécies de animais e de plantas em perigo de extinção e mesmo para se trazerem de volta algumas que tenham desaparecido recentemente. O ADN traz a possibilidade de se criarem novas bactérias geneticamente modificadas que sejam capazes de limpar o ambiente de toxinas nocivas, pois decompõem resíduos orgânicos (nocivos para o ambiente) e transformam-nos em água e dióxido de carbono.

É, também, através do ADN, que se podem criar os «bilhetes de Identidade genéticos» isto é, a partir dos genes de ADN que se encontram no núcleo das nossas células é possível reconhecer a nossa identidade de uma maneira que ninguém o possa negar, pois o nosso ADN é único. Ou então pode-se verificar a vericidade dos progenitores, com o teste de paternidade. Sendo nesta ideia que assenta também medicina forense, pois os médicos forenses, através da analise de sangue, pele, cabelo, saliva, etc, encontrados na cena do crime, podem identificar o ADN do criminoso e identifica-lo, comparando o ADN na base de dados.

Mas neste mundo de incertezas em que vivemos, a reflexão ética e cultural volta a estar no centro das atenções. Ao afirmar que estamos num momento de profunda transformação da sociedade, que afecta tanto a evolução das civilizações como a dos valores, certezas e modos de vida individuais e colectivos. Esta transformação que se esboça com a queda do muro de Berlim e que passa pelo selvagem atentado às Torres Gémeas do World Trade Center de Nova York, resultado da tensão racial ????? entre o Médio Oriente e os Estados Unidos, desenrola-se a um ritmo sem precedentes, num contexto de profundas assimetrias no qual coexistem grupos sociais num grau avançado de desenvolvimento, de liberdades públicas, de comunicações, de economia, de inovação e tecnológico.

Outros de carácter tribal, tradicional, que vivem ainda numa etapa quase pré - histórica e parecem destinados a sucumbir à ditadura desta transformação.

Mas temos de ter a noção cultural e ética que estas culturas, já há muito tempo assim vivem e não nos cabe a nós intervir e modificar os seus costumes e transformar as suas vidas.

Mas o valor ético e cultural aplica-se a varias situações de vida quotidiana neste mundo em que vivemos, por exemplo: as D.S.T., um individuo que seja portador de S.I.D.A. deve ou não avisar os seus parceiros sexuais, se proceder de forma ética e cultural, sentirá a necessidade de não omitir ao companheiro ou companheira que é portador de uma doença grave, potencialmente transmissível, se não tiverem os devidos cuidados, pois hoje em dia já existem vários meios ao acesso do mero cidadão para evitar tais transmissões.

Existem até formas de uma mãe portadora de S.I.D.A., ter filhos perfeitamente saudáveis. Devido ao avanço da ciência.

Pois a ciência e tecnologia nunca param, hoje em dia há de tudo os cd´s foram substituídos por leitores de mp3 e Ipod´s, as videocassetes tornaram-se obsoletos com o aparecimento dos leitores e respectivos dvd´s, a internet saiu da velocidade do caracol e tornou-se bastante mais rápida mas muito cara, as fotos passaram para o plano digital deixando os rolos fotográficos nas prateleiras, etc. Pois muitos dos meus passatempos passam pelas novas tecnologias ou seja o pc indispensável, navegar na Web, jogar ps2, etc.

Ver ligação

Nesta altura continuava a fazer alguns trabalhos com o meu pai, mas as pessoas responsáveis pelos pagamentos tornavam-se muito pouco credíveis.

Ver ligação

A 26 de Julho de 2008, após 6 anos de namoro chegou o casamento onde disse o sim a minha esposa Fátima Isabel Gonçalves da Silva perante a igreja já que somos ambos católicos. Mudei de casa mas fiquei na mesma freguesia onde vivemos felizes com o Nikku o nosso gato de estimação Persa.

Mas para uma bom ambiente familiar e preciso que haja responsabilidade na gestão do tempo e do orçamento familiar, no que diz respeito a gestão do tempo é muitas das vezes planear as coisas com antecedência, por exemplo decidir quando a família irá de ferias, é muito importante planear com antecedência para canalizar antecipadamente tempo e recursos financeiros para tal, ai entra a gestão do orçamento familiar. Para isso todos os meses calculo o valor líquido salarial familiar, e faço a programação deste, sabendo que x é para despesas correntes, como a renda da casa, gás, electricidade, prestações de créditos, compras para o agregado familiar e despesas necessárias diariamente, os combustíveis para deslocação para o local de trabalho.

Um x do dinheiro restante é para despesas relacionadas com o lazer, idas ao cinema, ao café, etc.

Por fim é muito importante por um x de dinheiro de lado para eventuais despesas não planeadas, como cuidados de saúde e para eventuais acontecimentos futuros como as férias, precisam de tempo para serem planeadas para ver o x de dinheiro disponível para tal, para assim anteciparmos os gastos e sabermos que destinos de lazer podemos tomar em função do dinheiro que foi possível por de parte no orçamento familiar todos os meses, que nem sempre é igual.

Por isto é que a programação do orçamento financeiro e do tempo disponível é tão importante para um ambiente saudável.

Nós na nossa vida doméstica utilizamos bastante a máquina de lavar roupa na programação do tempo, pois é um equipamento quase indispensável hoje em dia, porque de certa forma nos veio ajudar no seio familiar, principalmente na poupança de tempo que hoje em dia muitas das vezes se torna escasso. No meu caso, sei o básico sobre o funcionamento deste electrodoméstico, pois a minha esposa sente-se muito mais á vontade com a sua utilização, talvez devido ao tal estereotipo que tem vindo a esbater-se, que as mulheres e que deviam cuidar da lida da casa, lavando a roupa, loiça, arrumar a casa, etc. Mas hoje em dia as coisas já não são bem assim, as tarefas podem e devem ser partilhadas, e com a evolução da tecnologia estes aparelhos são cada vez simples de manusear, tanto por mim como pela minha esposa, acho que é uma forma de ultrapassar certas desigualdades da lida doméstica, nem que por vezes recorra ao manual de instruções para saber como funcionam os diferentes programas para diferentes tipos de roupa, saber que tipo de produtos são aconselhados a usar, perceber melhor por vezes o tipo de linguagem utilizada no aparelho e também saber a melhor forma de o utilizar poupando no seu consumo energético, rentabilizando o seu funcionamento.

Já que a ciência aliada a tecnologia nos proporciona o usufruir destes equipamentos, porque não os haveríamos de utilizar, mas também temos de pensar que estes aparelhos precisam de ter bastantes cuidados, já que muitos deles são submetidos a esforço elevado ou as vezes mal utilizados, por exemplo na maquina de lavar temos um limite de roupa que podemos por em cada lavagem, não devemos exceder, senão estaremos a forçar este electrodoméstico mas também não devemos pôr a lavar com pouca roupa isso também se torna prejudicial para o electrodoméstico como para aumentar o consumo energético, também tenho o cuidado especial de utilizar um produto que evite o deposito de calcário proveniente da água que se acumula nas partes vitais da maquina e acabam por as corromper muito rapidamente, por isso nunca devemos esquecer a manutenção dos nossos equipamentos e as suas correctas normas de utilização, que vêm bastante explicitadas no manual do utilizador, onde por vezes podemos saber a que se devem determinados tipos de avaria.

Mas para que hoje em dia tenhamos acesso a estes aparelhos tiveram de haver várias evoluções, como a invenção da electricidade como também os componentes electrónicos, motorizados, etc. Eu sei que hoje em dia quando ponho a máquina de lavar a trabalhar teve de haver um princípio que foi explorado de maneira a tornar estes processos mais fiáveis, perfeitos e simples para que a nossa tarefa seja mais simplificada.

Para que existisse a máquina de lavar houve várias invenções, para a pôr a trabalhar tenho de a ligar a electricidade que é constituída por uma corrente de electrões, depois vem a parte electrónica que e escolher no painel da maquina o programa que mais se adequa as diversas situações melhor desempenho, e depois accionamos a maquina e ai todos os seus componentes se conjugam, a electricidade faz com que primeiro a bomba bombeie a agua para dentro da maquina, para um reservatório estanque onde temos o tambor da maquina no qual se encontra a roupa, depois temos o motor eléctrico que da o poder da força centrifuga a máquina para girar o tambor e para que a agua aqueça dentro da maquina temos uma resistência que como o próprio nome indica é um fio condutor de electricidade mas de diâmetro reduzido que causa a resistência a passagem dos electrões que devido ao atrito aquecem a resistência que por sua vez aquece a agua, por fim depois do processo de lavagem temos a bomba de agua que bombeia a agua resultante para os esgotos.

A ciência está em constante evolução e nos temos de aprender a evoluir com ela e saber que os electrodomésticos são um bem comum seja para o homem ou para a mulher não deve haver diferenciações, cabe-nos a nós no nosso lar dividir as tarefas e nos adaptarmos a problemas que por vezes surgem na rotina diária e que devem ser solucionados, acho que é assim que devemos viver.

E por exemplo com o tempo que poupo com a máquina de lavar roupa, posso-me dedicar a outras coisas que acaba quase sempre no leitor de DVD, já que sou um fã da sétima arte, eu adoro ver filmes porque culturalmente evoluímos mais, porque ao utilizarmos o DVD estamos em contacto com vários aspectos, a experiência com que ficamos depois de ver um bom filme, temos de perceber de línguas estrangeiras já que alguns menus de DVD´S não tem em português ou por vezes o próprio leitor, e então isso faz-nos recorrer aos seus manuais de instruções para melhor desempenho e manuseamento do aparelho, e por vezes os manuais só tem inglês e por isso e importante saber compreender línguas estrangeiras, um bom filme ou documentários resultam muito no meu meio cultural, tiramos imensas contrapartidas, por vezes nem damos conta, pois muitas das vezes vejo filmes baseados em factos verídicos o que vem contribuir para a nossa cultura geral, até saber os nomes dos actores e dos realizadores é uma coisa que levo sempre em conta, ou se o filme foi baseado num livro por exemplo e depois ficamos interessados em o ler, etc.

Mas quando não é o DVD, vou para o PC e ai com a internet posso fazer muita coisa, principalmente contactar com os meus amigos, já que o computador se tornou uma ferramenta bastante eficaz e tem um papel muito positivo na sociedade se for usado com consciência e responsabilidade, mas muitas das vezes em casa também contacto com os meus amigos e familiares via telemóvel ou por chamada ou SMS, este também se tornou um equipamento quase imprescindível no nosso dia a dia domestico e social, já que e bastante autónomo podemos estar com ele em utilização em qualquer parte do mundo o que torna este equipamento bastante pessoal e importante para com comunicação familiar e não só, já que a mim me faz imensa falta no trabalho para comunicar com clientes, patrões, fornecedores, etc.

Em minha casa como forma de aquecimento doméstico, utilizo uma salamandra que adquiri recentemente, para evitar sobretudo consumos de energia elevados que eram causados pelos aquecedores eléctricos, com a salamandra tenho mais poder de aquecimento, mas também tenho de recorrer a lenha como fonte de calor, que para quem tem sistemas de aquecimento semelhantes ao meu, torna-se indispensável, mas temos de ter cuidados porque as árvores são uma parte integrante e muito importante do nosso ecossistema, por isso temos de nos empenhar na reflorestação e quando adquirirmos lenha se possível que seja de arvores secas resultantes muitas das vezes de um problema maior, os incêndios, um problema que continua a subsistir na nossa sociedade.

O calor basicamente propaga-se de três formas: por condução, a qual ocorre principalmente em matérias sólidas, por convecção, que ocorre em líquidos e em gases e por radiação, onde há necessidade de meio material para condução e propagação da energia calorífica.

Quando adquiri a salamandra também tive em atenção que esta desse para cozinhar, permitindo assim poupar gás. Eu moro no meio mais rural onde este tipo de aquecimento predomina, devido a grande parte das casas ser antigas e não terem técnicas de isolamento e aquecimento mais actuais

Pois actualmente existem várias formas e técnicas de construção que permitem a poupança de energia em termos de aquecimento por exemplo existe o poliuretano que é projectado na caixa de ar de uma casa ou prédio que ao mesmo tempo que isola as habitações do frio e calor, também as isola de possíveis infiltrações de humidade, o que vai optimizar o ambiente doméstico, permitindo o desperdício de energias no aquecimento. O que já não acontece em minha casa, devido ao mau isolamento e inexistência de vidro duplo a temperatura da casa depende muito do clima, mas com a salamandra atenuei pelo menos o frio de inverno.

Mas hoje em dia existem já formas de rentabilizar fontes de energia renováveis nas próprias casas, como os painéis foto voltaicos, compostos por células solares que são o elemento básico para transformar a radiação solar em energia eléctrica que e acumulada em baterias que quando estão abastecidas lançam a energia em excesso para a rede pública, diminuindo assim o consumo de energias não renováveis. Não tendo este tipo de técnica em casa posso recorrer a outros processos para economizar a energia utilizando lâmpadas de baixo consumo nas divisões da casa que mais são utilizadas, devemos também desligar os nossos televisores, leitores de musica e dvd, pc´s, etc, porque estes aparelhos mesmo em stand-by consomem energia, também devemos ter em conta que ao comprarmos um electrodoméstico esse seja classe A, classe que consome menos energia e evitar técnicas de aquecimento e arrefecimento que gastem electricidade em excesso. Também devemos ter a preocupação de poupar água, como ao lavar a loiça ter o cuidado de não deixar correr água a mais, poupar também quando se lava o carro, não utilizar água corrente.

E sempre que posso tento incentivar os meus familiares e amigos a seguir formas de utilização energética eficientemente, como outras pessoas me incentivaram a mim, e não nos podemos esquecer que não estamos só a contribuir para nossa redução de custos mas também para pouparmos os nossos recursos naturais que cada vez se tornam mais escassos.

O sol por exemplo é importante a estes sistemas, de energias renováveis, mas também e um elemento fundamental para a existência da vida na terra já que o sol e dos factores que mais contribui para o equilíbrio da temperatura a superfície da terra, mas também pode ser perigoso, devido ás radiações dos raios solares que passam para a terra e podem causar problemas de saúde as pessoas, mas isto só acontece devido á influência do homem na emissão de gases para a atmosfera, este tipo de poluição e resultante de vários factores como a poluição causada pelos gases dos automóveis, das fábricas, etc. Que fazem que com o filtro natural que a terra possui «Camada de Ozono» tenha vindo a diminuir e consequentemente a deixar passar muitos destes raios prejudiciais ao homem e á terra. Maior parte da poluição e emitida pelos países mais desenvolvidos, que não cumprem muitas das vezes com as normas estabelecidas no protocolo de Quioto. Ou seja, os grupos sociais têm aqui uma palavra a dizer, mas as vezes os interesses monetários sobrepõe a necessidade de cuidar do ambiente, então quem sofre com isso são as classes sociais mais pobres, que vêm sem poder fazer nada, o clima a degradar-se, muito também por causa dos estilos de vida das diferentes populações, basta ver a diferença de níveis de poluição emitidos pela América do Norte e do Sul, quem é mais rico tem mais industrialização, logo mais poluição para a camada do ozono, que é como uma capa que envolve a terra e está localizada na estratosfera, e a protege de vários perigos um deles por exemplo os raios ultravioletas. E com a redução deste protector da terra e seres vivos, cada vez estamos mais vulneráveis ao impacto que o aquecimento global acarreta, mais vulneráveis a doenças causadas pelo sol, o degelo das superfícies solares que faz com que o nível do mar suba e consequente as marés se venham a alterar e modificando cada vez mais o clima, por isso e preciso urgentemente tentar travar o que pode vir a ser uma catástrofe, por isso os países mais poluidores devido ao aumento generalizado da actividade industrial deveriam ser severamente punidos, e obrigados a adoptar normas que minimizem ao máximo a libertação de gases de efeito estufa, porque quanto mais gases são libertados mais o buraco no ozono criado por estes aumenta e consequentemente os perigos para a terra, é inevitável se continuarmos assim que a terra dentro de anos se torne cada vez mais instável a nível climatérico, com o constante degelo dos pólos e subida do nível do mar.

Muito se tem discutido sobre estes assuntos, principalmente nos media, quer seja em debates com ambientalistas, cientistas, industriais, como as sondagens e documentários e até filmes baseados em situações ambientais verídicas, para ver se acordam muita gente para a dura realidade antes que seja tarde demais.

Pois existem várias soluções que começam a ser estudadas e algumas já se encontram em execução, como o controlo rigoroso dos combustíveis e o seu grau de pureza, criação de dispositivos de controlo de poluição, vistoria nos veículos motores, para retirar de circulação os desregulados e nos modelos mais antigos a exigência de instalação de filtros especiais nos escapes, incentivar as pessoas a deixarem seus carros em casa pelo menos dois dias, organizando assim, um sistema de boleia, e a utilizarem mais os transportes colectivos, melhoria e segurança no sistema de transporte colectivo, interdição do ar condicionado, frigorífico e outros produtos que usam CFC´s, incentivo às pesquisas para a elaboração de substitutos do CFC´s, investimentos nas fontes alternativas de energia e na elaboração de novos tipos de combustíveis como o álcool vegetal (carros), extraído da cana-de-açúcar e do eucalipto, e do óleo vegetal (substitui o óleo diesel e o combustível para a aviação), extraído da soja, do algodão e do amendoim, melhor planeamento das cidades, interagir que haja harmonia entre a natureza e a urbanização, maior controlo fiscal do corte de arvores e incêndios nas matas e florestas, protecção e conservação dos parques ecológicos, incentivo a população para a reflorestação e campanhas de sensibilização da população para os riscos da poluição.

Com o meu interesse pelas novas tecnologias e mais conhecimento, á dois meses atrás o meu cunhado que frequenta a E.P.B. no último ano do curso de Marketing falou-me da existência das novas oportunidades e fiquei bastante interessado devido a poder melhorar a minha vida tanto como na realização pessoal como a nível profissional, inscrevi-me para dar o meu melhor.

O meu interesse por órgãos sociais mundiais é constante, por exemplo a O.N.U.« Organização das Nações Unidas» como o próprio nome indica esta é uma organização constituída por varias nações, actualmente 192 estados membros, esta organização foi fundada em 24 de Outubro de 1945 após o fim da segunda guerra mundial, um dos feitos mais notáveis desta organização foi a proclamação da Declaração dos Direitos Humanos em 1948.

Desde de pequeno que conheço esta instituição, principalmente através dos media, e aprecio bastante as suas acções em todo mundo, como as outras instituições dela inerentes como por exemplo a Unicef que se dedica a um tipo de população mais frágil, as crianças.

Os objectivos da O.N.U. após a sua criação são fazer tudo que tiver ao seu alcance para manter a paz mundial, protegendo também os direitos do homem e ajudando e promovendo o desenvolvimento de várias nações principalmente em África encorajando países dependentes a entregar a sua própria autonomia e manter os estados soberanos a par das desigualdades e crueldades que se praticam um pouco por todo o mundo, os capacetes azuis são a sua força que se mantém na frente da linha tentando apaziguar nações em conflito.

A organização é financiada voluntariamente pelos estados membros, uma grande parte das despesas da O.N.U. são com a manutenção de paz já que eles actuam em todos campos onde haja conflito e desrespeito pelos direitos humanos e tentar evitar que essa violência alastre a pessoas inocentes mas sem possibilidade de defesa e aí África e um dos países mais vulneráveis por estar no limiar da pobreza extrema devido a governantes altamente corruptos que fazem desaparecer as riquezas de África para beneficio próprio, o terreno africano e abundante em riquezas com o petróleo e mais conhecidos diamantes de sangue que matam muita gente pois essas riquezas são usurpadas por tiranos que se dizem bons governantes, pois o papel da O.N.U. e evitar e erradicar tal comportamento mesmo com os seus membros corram perigo.

Esta instituição sobretudo dedica-se à monitorização de que os países cumprem com os direitos fundamentais da declaração universal aqui seguem alguns exemplos:

Artigo I

Todas as pessoas nascem livres e iguais em dignidade e direitos. São dotadas de razão e consciência e devem agir em relação umas às outras com espírito de fraternidade.

Artigo II

Toda pessoa tem capacidade para gozar os direitos e as liberdades estabelecidos nesta Declaração, sem distinção de qualquer espécie, seja de raça, cor, sexo, língua, religião, opinião política ou de outra natureza, origem nacional ou social, riqueza, nascimento, ou qualquer outra condição.

Artigo III

Toda pessoa tem direito à vida, à liberdade e à segurança pessoal.

Artigo IV

Ninguém será mantido em escravidão ou servidão, a escravidão e o tráfico de escravos serão proibidos em todas as suas formas.

Artigo V

Ninguém será submetido à tortura, nem a tratamento ou castigo cruel, desumano ou degradante.

Artigo VI

Toda pessoa tem o direito de ser, em todos os lugares, reconhecida como pessoa perante a lei.

Desde que nasci até agora, sempre vivi no meio rural, actualmente por opção própria e por isso para mim e fácil identificar as diferenças do meio rural e urbano, os ambientes rurais apesar do decréscimo ao longo dos tempos continuam a ter profissões e métodos que só se tornam possíveis neste meio, o mais importante e conhecido de toda a gente será a agricultura e vinicultura, eu posso falar por experiência própria pois observei os meus pais, ao longo da minha infância em actividades agrícolas para consumo doméstico, desde de o cultivo de batatas, verduras, produção de vinho, etc. Pois apesar dos meus pais ocuparem muito do tempo nos seus empregos nunca deixaram de praticar estas técnicas, mesmo que seja numa escala reduzida, como já disse para consumo próprio.

Mas também tive e tenho a oportunidade de observar pessoas que a sua única forma de sustento passa pelas actividades agrícolas, ou a estas ligadas, conheço casos concretos de pessoas que cultivam em grande escala, para consumo próprio e para venda, para a obtenção de dividendos monetários para continuar a subsistir nesta actividade, e estes dividendos são adquiridos de vários tipos de culturas, seja da produção de vinho, milho, batatas, centeio, etc. Todos estes produtos têm a sua fase ao longo do ano, desde o seu cultivo á sua colheita, onde em seguida dará lugar ao cultivo de outro produto dependendo da época do ano, inseridos nas actividades agrícolas estão vários produtos químicos, adequados a diversas intervenções, os adubos por exemplo, que são compostos por vários macronutrientes, ex: carbono, nitrogénio, oxigénio, potássio, e micronutientes, ex: boro, cobalto, zinco, também são utilizados herbicidas para controlo de ervas daninhas, como os pesticidas para controlo de pragas que se podem vir a abater sobre as plantações, um dos únicos inconvenientes destes produtos e que apesar de não serem considerados venenos, contem várias matérias tóxicas prejudiciais ao ambiente, por isso cada vez mais se fala da agricultura biológica, que se abstêm destes produtos, mas com inconveniente de se tornarem mais caros. Existem outros processos utilizados no meio rural como a salmoura, que é um processo em que o sal é fundamental na conservação de bens alimentares, esta técnica era fundamental antigamente, pois a falta de frigoríficos, este era um processo bastante eficaz, outro processo é o fumeiro que através do fumo seca a carne, protegendo-a de agentes externos nocivos, processo que ainda hoje e bastante utilizado para o comércio de enchidos e presuntos.

Outra profissão bastante ligada á agricultura é a agro-pecuária, pois apesar das técnicas de cultivo hoje em dia estarem bastantes mecanizadas, longe vai o tempo onde as vacas eram utilizadas como motor na agricultura. Com o tempo apareceram novas técnicas, novas máquinas, novos meios de subsistência rural e a sua divulgação, um caso bastante conhecido será o turismo rural que veio definitivamente mostrar a muitas pessoas o mundo rural, com o acréscimo positivo de actividade económica, quer seja na criação de novos postos de trabalho, e divulgação de actividades bastante importantes ao nosso país, com o turismo rural Portugal ficou mais rico, não a nível monetário mas mais pelo desenvolvimento de actividades rurais, com isto passaram a ser investidas mais verbas neste meio, quer em actividades ligadas á floresta ou até no restauro do património rural.

Ao longo da extensão geográfica do nosso país existem também várias variantes fonéticas, lexicais e semânticas, por exemplo o mirandês, língua românica com forte tradição oral, que é falado por cerca de 15 mil pessoas em Miranda do Douro, aqui ficam alguns exemplos da sua fonologia, ex: língua - lhéngua, lua - lhuna, ano - anho, ferro - fierro.

É muito importante preservar o nosso património rural e urbano, como herança cultural, não deixar cair no esquecimento.

Houve um caso na minha freguesia, onde houve um debate exaustivo para a preservação do património rural, que foi a construção de uma ponte para auto-estrada sobre uma parte da freguesia, que gerou controvérsia pública acerca do trajecto, pois uma ponte com cerca de 300m de extensão e 40m de altura, não é um cenário idílico para um meio rural, o debate centrou-se no ponto do desenvolvimento, temos de pensar que por vezes o desenvolvimento de novas vias de comunicação, acabam por interferir pelo aspecto positivo no desenvolvimento rural, mas pelo negativo em termos de paisagem.

Na minha família actualmente, a minha avó é alvo de conflito entre os seus filhos, meus tios e tias, porque eu gosto bastante da minha avó e não estou a gostar de a ver a passar por esta situação, a minha avó há uns anos atrás teve de ser operada aos intestinos e do resultado dessa operação ficou a fazer as necessidades por uma sonda colocada na barriga mas já não lhe bastava esse problema ainda teve de colocar próteses nas ancas e por isso tem de ter muito cuidado ao deslocar-se, sempre com ajuda de uma canadiana, mas isso não a impediu de continuar independente e continuar na sua casa com a lida de casa e do campo, já que a minha avó sempre foi feirante, corria as feiras a vender os seus vegetais. Até que um dia uma tia minha com bastantes possibilidades, a nível de espaço e tempo resolveu convencer a minha avó a deixar a sua casa para ir viver com ela, a minha avó relutante acabou por aceitar. Até que há pouco tempo começaram a surgir problemas para com a minha avó na casa dessa minha tia, não sei se a nível pessoal mas o que sei e que decidiu dizer á minha avó que não a queria mais na sua casa, atitude que me indignou imenso, porque convenceu a minha avó a deixar a sua antiga casa onde passei vários momentos felizes, que era alugada e o aluguer era bastante acessível á reforma dela, era o seu cantinho, desde aí a minha avó não tem casa certa tendo de recorrer ao resto dos filhos para se refugiar um pouco até que uma outra tia minha a acolheu por também ter bastante espaço, mas não tanto tempo disponível para com a minha avó, já que o resto dos filhos não têm espaço disponível para a acolher e todos trabalham.

O que eu retirei desta situação de vida é que a minha tia talvez não tivesse pensado bem nas consequências antes de levar a minha avó, que depois de deixar a sua casa viu-se dependente de outros, e agora o problema subsiste porque á sua casa já não pode voltar e que resolução haverá para este caso, eu e maior parte dos familiares discordamos em coloca-la num lar outros dizem que seria a melhor solução, será?

Será que a minha avó terá de viver assim ate ao resto dos seus dias, sabendo que e ajudada por uns e rejeitada por outros, no fim aqui existiu uma grande falta de responsabilidade e é uma injustiça para com a minha avó, que era independente e se tornou dependente por causa de uma situação mal pensada, e agora para mim cabe a todos os filhos se reunir e decidir de acordo com a minha avó o que e melhor para ela e acabar de vez com este conflito familiar.

Já que a minha avó quer novamente ter a sua independência, eu sou a favor que se alugue uma casa para ela, com condições que se ajustem a sua saúde, e como ela têm muitos filhos, netos e até bisnetos o apoio familiar nunca lhe vai faltar, já que também somos uma família grande e unida.

Writing Services

Essay Writing
Service

Find out how the very best essay writing service can help you accomplish more and achieve higher marks today.

Assignment Writing Service

From complicated assignments to tricky tasks, our experts can tackle virtually any question thrown at them.

Dissertation Writing Service

A dissertation (also known as a thesis or research project) is probably the most important piece of work for any student! From full dissertations to individual chapters, we’re on hand to support you.

Coursework Writing Service

Our expert qualified writers can help you get your coursework right first time, every time.

Dissertation Proposal Service

The first step to completing a dissertation is to create a proposal that talks about what you wish to do. Our experts can design suitable methodologies - perfect to help you get started with a dissertation.

Report Writing
Service

Reports for any audience. Perfectly structured, professionally written, and tailored to suit your exact requirements.

Essay Skeleton Answer Service

If you’re just looking for some help to get started on an essay, our outline service provides you with a perfect essay plan.

Marking & Proofreading Service

Not sure if your work is hitting the mark? Struggling to get feedback from your lecturer? Our premium marking service was created just for you - get the feedback you deserve now.

Exam Revision
Service

Exams can be one of the most stressful experiences you’ll ever have! Revision is key, and we’re here to help. With custom created revision notes and exam answers, you’ll never feel underprepared again.