Print Email Download Reference This Send to Kindle Reddit This
submit to reddit

Gene Knockout Therapy In Yeast Using Homolohous Recombination Biology Essay

Gene is a hereditary unit that contain sequence of DNA. It occupies a unique location on a chromosome which helps to give a particular characteristic in an organism. Genes also encode for the protein that are required by the organism. Unfortunately, sometimes gene undergoes alteration which disrupts the amino sequence of a particular protein, which results in gene mutation. Permanent change in the DNA sequence of a gene is called mutation. There are different types of mutation such as point mutation, frame-shift mutation, insertion, deletion etc. These mutations are either caused by environmental factors such as radiation, or inherited from parent, or during DNA replication. Cystic fibrosis, sickle cell anaemia etc are example of diseases caused by mutations in gene. Nevertheless, with the help of certain advance technology many genetic mutations can be treated. One such treatment for genetic disorder is known as gene therapy. Gene therapy technique is a potential approach which is designed to replaced a faulty gene with the insertion of normal gene into a nonspecific location within the genome. This technique helps to restore important protein with in an organism; as a result many diseases are eliminated from the body. There are couple of approaches to correct the faulty gene such as the use of homologous recombination, or repairing the faulty gene through selective reverse mutation so that it could restore its normal function or the regulation of a specific gene can be controlled.

Homologous recombination occurs when identical segments are exchanged between two homologous DNA molecules. It is also known as DNA crossover. Homologous recombination occurs during meiosis and it involves in the breaking, exchanging and rejoining of the two homologous. The product of this recombination is the exchanged gene. The process of recombination prevents mutation from occurring because this type of recombination does not involve in any gain or loss of nucleotide.

One of the common approaches of gene therapy is homologous recombination. It involves in the swapping of the non functioning gene with a normal functioning gene. To accomplish this process gene knockout or the detection of the target gene is essential. Gene knockout is the primary step in gene therapy because it helps to identify the target gene so that the gene of interest can be easily replaced with the help of homologous recombination. The effect of replaced gene on organism can then be studied.

The systematic gene knockout of mouse genes is required to study and identify gene responsible for hundreds of human disease. This process takes months or years because mouse is a diploid and multi-cellular and in order to analyze the effect of gene deletion both copies of gene must be deleted. However, yeast Saccharomyces cerevices (S. cerevices), is a haploid, unicellular and deletion in only one copy of gene will show phenotype manifestation.

The objective of this experiment was to delete ADE2 gene from yeast (S. cerevices), with the help of hybrid piece of DNA that was generated from the polymerase chain reaction technique (PCR). ADE2 gene is encodes the purine bio synthesis in yeast (S. cerevices).

The hybrid DNA that was amplified from PCR, consisted of 5’and 3’ un-translated region (UTRs) of the ADE2 gene and the TRP 1 gene that consists of a protein coding sequence. TRP1 gene encodes for the tryptophan biosynthesis. In addition, with help of homologous recombination process, the 5’and 3’ UTRs present in ADE2 identified ADE2 gene that was present within the yeast genome, this steps was gene targeting step. During this step, ADE2 gene was swapped by TRP1 gene. Yeast requires tryptophan (trp) because it carries essential amino acid, and if not present may lead yeast death. Nevertheless, tryptophan was deleted from the yeast genome and because of this yeast depends on the media to fulfill its requirement of (trp+). Wild-type TRP1 gene was inserted in place of ADE2 gene, of the yeast genome. The manipulation in the genes affected the phonotype of the yeast.The swapping of gene transformed the cream coloured yeast to red/pink coloured yeast. This happened because, the removal of ADE2 gene from the yeast genome, also impaired yeast ability to biosynthesized purine, because of this purine precursor started accumulating in the vacuole of the yeast, thus yeast appearing red/pink color on the media. This verified that the gene was successfully knocked out and the gene therapy is the transformation from the tryptophan dependence to tryptophan independence.

The number of colonies that appeared on the plates helped to calculate the transformation efficiency. Transformation efficiency is a quantitative approach to calculate the number of cells that have taken up the foreign DNA. The hypothesis of the experiment was that ADE2 gene will be swapped with TRP1 gene, with the help of homologous recombination approach of gene therapy. The appearance of red/pink yeast would confirm the success of the gene knockout, whereas growth on –trp media would confirm the insertion of TRP1 gene.

Materials/Methods:

PCR reaction mix composed of Taq DNA polymerase,10x buffer, dNTP mix, PCR primers forwards:5’CAATCAAGAAAAACAAGAAAATCGGACAAAACAATCAAGTCGGATCCCCGGGTTAATTAA3’and reverse5’TTTTATAATTATTTGCTGTACAAGTATATCAATAAACTTAGAATTCGAGCTCGTTTAAAC3’ were used. Plasmid DNA template composed of pFA6a-TRP1 (0.151 µg/µL) and DNA thermal cycle was used.100bp ladder, electrophoresis apparatus, agarose, and 0.5x TBE buffer. YPD liquid yeast media, six synthetic defined yeast media lacking tryptophan agar plates (SDA-trp) were used. S. cerevisae (ATCC # 4007202) obtained from lab stock, transformation reagent composed of 25ml sterile water, 1.1mL of 0.1M lithium acetate in TE buffer (sterile), 600µL of 40% PEG in 0.1M lithium acetate/TE (sterile), 50µL of salmon sperm carrier DNA at 2 mg/mL and DMSO were used. Shaking incubator, water bath, incubator were used.

PCR to generate ADE2/TRP1 hybrid construct: Two 0.5ml tubes were labeled + DNA (carrying template DNA) and “-DNA” no DNA. Microcentrifuge tube was prepared after addition of the master mix volumes accordingly: 12.5µl of 10x plolymerase buffer to reach the final concentration in reaction to 1x, 9.4 µl of 20mM MgSO4 to reach at 1.5mM, 3.75µl of 10mM dNTP Mix to reach at 300µM each, 12.5 µl of primer 1 and 2 to reach 0.5 µM. 1.25 µl of Taq polymerase to reach final concentration of 2.5unites and 66.85 µl of sterile H2O. Template DNA was not added to avoid premature reactions. Master mix contents were mixed by vortex and 47.5 µl of Master mix was transferred into +/- PCR labeled tubes. 2.5µl of DNA template pFA6a-TRP1was added in + tube, and 2.5µl of sterile H2O was added to – tube. PCR tubes were then transferred to thermocycler to run PCR program according to the instructions provided on page 23 of Hausner and de Jong, 2010, once the PCR reaction were completed, tubes were frozen at -20°C.

Confirmation of PCR product generation: 2% agarose gel was prepared in 0.5x TBE buffer with the addition of 2 µl of ethidium bromide. 5µl from each tube was transferred into 1.5ml centrifuge tube. 2 µl of loading dye was added to the sample. Samples and 100bp DNA ladder were loaded onto the gel and the process of electrophoresis was started for 45minutes at 100volts. Once the gel electrophoresis was completed, gel was placed on saran wrap to be scanned. The remaining PCR reactions were frozen at -20°C.

Transformation of yeast with hybrid PCR product using lithium acetate: A culture of S. cerevisae was harvested at 0.6-1 × 108cells/mL. 25mL of yeast culture was centrifuged at 5100 rpm for 5 minutes. Pallet was resuspended in 0.1M lithium acetate. Two tubes were labeled + and -. Add the reagents accordingly as mentioned on page 23 of Hausner and de Jong, 2010. Each tube was mixed through vortex, and incubated for 1.5 hours. 35µl of DMSO was added and tubes were centrifuge at 6-8000rpm for 15 seconds. Supernatant was removed and 0.5 µl of sterile water was added. Using sterile spread plate technique, 2×200µL and 1×100µL of each transformation was spread onto 6 –trp plates. After drying, plates were incubated at 30°C for 2-3 days.

Analyze yeast transformation results: The plates were observed for the presence of red and cream colored colonies. Transformation score was calculated after counting the number of colonies that appeared on the plates. Please refer to Experiments in Biotechnology Laboratory Manual (Hausner and de Jong, 2010) for detailed lab procedure.

Results:

100bp ladder

1 2 3 4 5 6 7 8C:\Users\Vampire\Desktop\Miriam%20yeast%20pcr.jpgladder.gif

Figure : Image shows 2% agarose gel electrophoresis results. Lane 1 and lane 8 contain 100 DNA ladder marker. Lanes 2 to 6 show the 1000bp PCR product whereas lane 7 shows the result for negative control without DNA. The band positions of the 100bp DNA ladder are also shown separately on the right side of the gel image.

Discussion:

The aim of this experiment was to incorporate TRP1 gene at the place of ADE2 gene in yeast. In order to accomplish this task, PCR technique was used to amplify the ADE2/TRP1 DNA hybrid. This hybrid DNA contained 5’and 3’ un-translated regions of ADE2 gene region and wild –type TRP1 gene, used as selection marker.TRP1codes for amino acid tryptophan. Plasmid contained the TRP1 gene flanked by 5’and3’ untranslated region, which is 40bp long homology to ADE2 gene. ADE2 gene was deleted out of yeast, S. Cerevisae genome through a process of homologous recombination which makes use of 40bp long homology.

Forward and reverse primers were used to elongate the DNA template strands and served as a starting point for the Taq polymerase. The reason behind using these primers is that forward primer and reverse primers had complementary sequence of their template DNA strands which would help to regenerate the double stranded DNA after every PCR cycle. The final product that was produced after running 32 PCR cycle was approximately 1000bp in length. This product contained TRP1 gene flanked by 5’ and3’ untranslated region of ADE2 gene. To confirm that the hybrid ADE2/TRP1 was formed successfully, gel electrophoresis technique was used. DNA was loaded in five lanes, lanes 2 to 6 as shown in the figure 4, to ensure the accuracy of the PCR reaction. DNA was loaded on a 2% agarose gel along with 100bp DNA ladder to identify the position of the bands relative to this marker. The gel was run for 45 minutes. As shown in figure 4, lane from 2-6 contained 1 dark band and relative to the marker the band size appeared to be 1000bp. This confirmed that the PCR reaction was successful and desired product has formed.

Nevertheless, there were few light bands that were also apparent on the gel. These bands could have appeared because of primer dimerzation. Primer dimerization is fairly a common phenomenon, and it happens when primers bind with each other instead of binding with the template DNA.

Lane 7 was loaded with negative control which did not contain any template DNA. No results were expected in this lane and, as indicated by the gel image, no bands appeared in lane 7.

One of the problems that occurred for PCR reaction was that none of group members were able to get the results. Therefore, gel image for PCR was supplied by Lab Technician. Multiple reasons could cause a failed PCR reaction. For example, while preparing the samples, and PCR Master Mix, contamination could occur, which caused the failure the reaction. PCR requires optimal temperature to proceed. For example, primer annealing temperature must be 54-60°C, otherwise primers do not anneal to the template DNA. Thus, it might be the case that Thermal cycler was not set properly which ended up in a failed PCR. Lastly, if dNTPs are not supplied enough, then a less product forms. Therefore, it might the case dNTPs were not mixed in the PCR solution, which resulted in small PCR product and which in turn did not show on the gel. It must also be noted that some times, Taq plomerase halts its activity when optimum temperature is not provided.

Table 1 and 2 show the results for the transformation. Table 2 shows results for negative control. Theoretically, no growth was expected because negative control did not carry the PCR product. Results fulfilled the expectation as no colony formation occurred for negative control.

Table 1 shows the results for positive control which contained PCR product. Media used to grow the yeast cells in order to verify the transformation, Synthetic defined yeast media lacking tryptophan (SDA -Trp). This was the selection method to select for the transformants. The yeast strain prior to use was knocked out of TRP1 gene, and hence was unable to survive on –trp media. Thus the cells that would grow on the –trp media must contained TRP1 gene, which was the indication of transformation. Also, to verify the deletion of ADE2 gene, a change in the phenotype, i.e. colony color changes from cream to red, was expected.

As it was apparent from table 1, that two types of colonies were observed on the plates, i.e., Red and cream. Red colored colonies are the result of gene deletion, i.e. ADE2 gene was knocked out. This happened through the process of homologous recombination, in which the 5’ and 3’ untranslated regions of ADE 2 attached with TRP1 gene, joined their homologs present on ADE 2 gene within the yeast genome. This resulted in the deletion of ADE2 gene.

During homologous recombination, the regions of homology tight bind with each other. After an exonuclease produces a double stranded nick, one of the strands invade the DNA strand. RecA proteins are involved in this process. As a result of this process, DNA gets exchanged. Figure … shows the homologous recombination event that occurred in this experiment to delete the ADE2 gene.

Thus in red colonies, ADE2 gene was replaced with TRP1 and as observed, cells were able to grow on –trp media. This is a clear indication of successful transformation. Also, the red color indicated the success of ADE2 deletion. In the absence of ADE 2 cells were unable to produce purine, and hence purine precursors accumulated which resulted in the reddish colony formation.

Cream color colonies, could be considered as transformant as well because they were able to grow on –trp media. But the problem with these cells is that they indicate a failed homologous recombination. These cells could not get their ADE2 gene deleted and hence no red color appeared. It must be noted, that since these cells were able to grow on –trp media hence they must contained TRP1 gene as well. A number of explanations are possible. For example, spontaneous mutation could have occurred which reverted back the deleted –trp gene in the original yeast strain. It can also be said that perhaps TRP1 gene never got deleted from some of the cells in the original strain. One of the strong arguments to explain the appearance of cream colonies could be the happening of an illegitimate recombination in which TRP1 gene actually got attached itself to some other portion of Yeast DNA. Thus ADE 2 never got a chance to get deleted.

The % transformation was calculated using red colonies. For the 200µL plates, the % transformation was 0.000001% and transformation efficiency was 1.47 trans./µg of DNA. Similarly for 100µL tube, the %transformation was 0.0000025% and transformation efficiency was 3.68 trans./µg of DNA. The pattern implies that the % transformation was rather low. It has been demonstrated previously that the probability of transformation occurrence is close to 0.0001. Thus taking into account this probability, results of the current experiment actually were not bad. At the same time, using a more advanced technique such as electroporation could improve these results.

Print Email Download Reference This Send to Kindle Reddit This

Share This Essay

To share this essay on Reddit, Facebook, Twitter, or Google+ just click on the buttons below:

Request Removal

If you are the original writer of this essay and no longer wish to have the essay published on the UK Essays website then please click on the link below to request removal:

Request the removal of this essay.


More from UK Essays

Doing your resits? We can help!